ID: 1123970731

View in Genome Browser
Species Human (GRCh38)
Location 15:25505670-25505692
Sequence ACATTAGAGCATAAGGCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123970726_1123970731 11 Left 1123970726 15:25505636-25505658 CCTGCACAGTAAGCAGATGCTGA No data
Right 1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG No data
1123970725_1123970731 19 Left 1123970725 15:25505628-25505650 CCTTAGCTCCTGCACAGTAAGCA No data
Right 1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG No data
1123970723_1123970731 23 Left 1123970723 15:25505624-25505646 CCTCCCTTAGCTCCTGCACAGTA No data
Right 1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG No data
1123970724_1123970731 20 Left 1123970724 15:25505627-25505649 CCCTTAGCTCCTGCACAGTAAGC No data
Right 1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123970731 Original CRISPR ACATTAGAGCATAAGGCACC GGG Intergenic
No off target data available for this crispr