ID: 1123977056

View in Genome Browser
Species Human (GRCh38)
Location 15:25563587-25563609
Sequence GTGTGGAGGGCACTGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123977048_1123977056 20 Left 1123977048 15:25563544-25563566 CCTGATTTGGCGTTTTGTTGTCA No data
Right 1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123977056 Original CRISPR GTGTGGAGGGCACTGTGATG TGG Intergenic
No off target data available for this crispr