ID: 1123978144 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:25572355-25572377 |
Sequence | ATTGGCAGGCTAGAGACGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123978139_1123978144 | -5 | Left | 1123978139 | 15:25572337-25572359 | CCAAAATCTGCAGGGTAGATTGG | No data | ||
Right | 1123978144 | 15:25572355-25572377 | ATTGGCAGGCTAGAGACGCGGGG | No data | ||||
1123978136_1123978144 | 22 | Left | 1123978136 | 15:25572310-25572332 | CCTACAAGACTGTGGAAGCTTGT | No data | ||
Right | 1123978144 | 15:25572355-25572377 | ATTGGCAGGCTAGAGACGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123978144 | Original CRISPR | ATTGGCAGGCTAGAGACGCG GGG | Intergenic | ||