ID: 1123978144

View in Genome Browser
Species Human (GRCh38)
Location 15:25572355-25572377
Sequence ATTGGCAGGCTAGAGACGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123978139_1123978144 -5 Left 1123978139 15:25572337-25572359 CCAAAATCTGCAGGGTAGATTGG No data
Right 1123978144 15:25572355-25572377 ATTGGCAGGCTAGAGACGCGGGG No data
1123978136_1123978144 22 Left 1123978136 15:25572310-25572332 CCTACAAGACTGTGGAAGCTTGT No data
Right 1123978144 15:25572355-25572377 ATTGGCAGGCTAGAGACGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123978144 Original CRISPR ATTGGCAGGCTAGAGACGCG GGG Intergenic