ID: 1123980321

View in Genome Browser
Species Human (GRCh38)
Location 15:25596363-25596385
Sequence GCCTGGAAACAGATGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123980321_1123980327 25 Left 1123980321 15:25596363-25596385 CCATAGACCATCTGTTTCCAGGC No data
Right 1123980327 15:25596411-25596433 TACATTTTCAAAGACCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123980321 Original CRISPR GCCTGGAAACAGATGGTCTA TGG (reversed) Intergenic
No off target data available for this crispr