ID: 1123982744

View in Genome Browser
Species Human (GRCh38)
Location 15:25619029-25619051
Sequence CAGCAAACTGCAGCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123982744_1123982749 8 Left 1123982744 15:25619029-25619051 CCTCCCACAGCTGCAGTTTGCTG No data
Right 1123982749 15:25619060-25619082 CATTCCATGCTCCAGGCTCTTGG No data
1123982744_1123982748 1 Left 1123982744 15:25619029-25619051 CCTCCCACAGCTGCAGTTTGCTG No data
Right 1123982748 15:25619053-25619075 GTTGGCTCATTCCATGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123982744 Original CRISPR CAGCAAACTGCAGCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr