ID: 1123983456

View in Genome Browser
Species Human (GRCh38)
Location 15:25623818-25623840
Sequence AGAGCTGGGTGGAGGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123983456_1123983464 -7 Left 1123983456 15:25623818-25623840 CCCCCTGGCCTCCACCCAGCTCT No data
Right 1123983464 15:25623834-25623856 CAGCTCTGAAAAGCTTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123983456 Original CRISPR AGAGCTGGGTGGAGGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr