ID: 1123986182

View in Genome Browser
Species Human (GRCh38)
Location 15:25648230-25648252
Sequence CCTTCCTCCAGGGGCCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123986182_1123986189 -7 Left 1123986182 15:25648230-25648252 CCCTCGAGGCCCCTGGAGGAAGG No data
Right 1123986189 15:25648246-25648268 AGGAAGGAGGCACAGTACATTGG No data
1123986182_1123986190 1 Left 1123986182 15:25648230-25648252 CCCTCGAGGCCCCTGGAGGAAGG No data
Right 1123986190 15:25648254-25648276 GGCACAGTACATTGGATCTGTGG No data
1123986182_1123986191 25 Left 1123986182 15:25648230-25648252 CCCTCGAGGCCCCTGGAGGAAGG No data
Right 1123986191 15:25648278-25648300 TGAGCAGATACATTGATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123986182 Original CRISPR CCTTCCTCCAGGGGCCTCGA GGG (reversed) Intergenic
No off target data available for this crispr