ID: 1123986647

View in Genome Browser
Species Human (GRCh38)
Location 15:25652436-25652458
Sequence GTTGTCAGCAGAATCAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123986647_1123986651 5 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986651 15:25652464-25652486 GCCTTAGACTACCCAAGGCTTGG No data
1123986647_1123986655 14 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986655 15:25652473-25652495 TACCCAAGGCTTGGAGAGGGAGG No data
1123986647_1123986659 29 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986659 15:25652488-25652510 GAGGGAGGCTCTAGGACTGCTGG No data
1123986647_1123986654 11 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986654 15:25652470-25652492 GACTACCCAAGGCTTGGAGAGGG No data
1123986647_1123986653 10 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986653 15:25652469-25652491 AGACTACCCAAGGCTTGGAGAGG No data
1123986647_1123986658 21 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986658 15:25652480-25652502 GGCTTGGAGAGGGAGGCTCTAGG No data
1123986647_1123986660 30 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986660 15:25652489-25652511 AGGGAGGCTCTAGGACTGCTGGG No data
1123986647_1123986650 0 Left 1123986647 15:25652436-25652458 CCTCCTTTGATTCTGCTGACAAC No data
Right 1123986650 15:25652459-25652481 TTCAGGCCTTAGACTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123986647 Original CRISPR GTTGTCAGCAGAATCAAAGG AGG (reversed) Intergenic
No off target data available for this crispr