ID: 1123987289

View in Genome Browser
Species Human (GRCh38)
Location 15:25657029-25657051
Sequence CGGCGAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123987289_1123987298 19 Left 1123987289 15:25657029-25657051 CCGTCCACCACTGCTGTTCGCCG No data
Right 1123987298 15:25657071-25657093 GACTTCCACCCCTCCGGATCCGG 0: 31
1: 87
2: 117
3: 65
4: 76
1123987289_1123987299 23 Left 1123987289 15:25657029-25657051 CCGTCCACCACTGCTGTTCGCCG No data
Right 1123987299 15:25657075-25657097 TCCACCCCTCCGGATCCGGCAGG 0: 12
1: 72
2: 148
3: 164
4: 147
1123987289_1123987296 13 Left 1123987289 15:25657029-25657051 CCGTCCACCACTGCTGTTCGCCG No data
Right 1123987296 15:25657065-25657087 TCCATTGACTTCCACCCCTCCGG No data
1123987289_1123987301 24 Left 1123987289 15:25657029-25657051 CCGTCCACCACTGCTGTTCGCCG No data
Right 1123987301 15:25657076-25657098 CCACCCCTCCGGATCCGGCAGGG 0: 14
1: 74
2: 165
3: 149
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123987289 Original CRISPR CGGCGAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr