ID: 1123987571

View in Genome Browser
Species Human (GRCh38)
Location 15:25658777-25658799
Sequence GGCGGACGCGGGGGAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123987555_1123987571 27 Left 1123987555 15:25658727-25658749 CCGAGGGGAGGAAGCTTCCACGG No data
Right 1123987571 15:25658777-25658799 GGCGGACGCGGGGGAGCCGGGGG No data
1123987557_1123987571 10 Left 1123987557 15:25658744-25658766 CCACGGAGCAGCTTCAGCTTCAG No data
Right 1123987571 15:25658777-25658799 GGCGGACGCGGGGGAGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123987571 Original CRISPR GGCGGACGCGGGGGAGCCGG GGG Intergenic