ID: 1123988393

View in Genome Browser
Species Human (GRCh38)
Location 15:25665248-25665270
Sequence GTTTATCTGAAGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123988388_1123988393 10 Left 1123988388 15:25665215-25665237 CCAAGGAGCATCTGTGTAAAAGT No data
Right 1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123988393 Original CRISPR GTTTATCTGAAGAGGGTGGC AGG Intergenic
No off target data available for this crispr