ID: 1123991462

View in Genome Browser
Species Human (GRCh38)
Location 15:25686799-25686821
Sequence GGCCATGTGGTCCATCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123991456_1123991462 28 Left 1123991456 15:25686748-25686770 CCTCAGTAAAATATCTAGAAATC 0: 1
1: 0
2: 2
3: 77
4: 605
Right 1123991462 15:25686799-25686821 GGCCATGTGGTCCATCCTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123991462 Original CRISPR GGCCATGTGGTCCATCCTGC AGG Intronic
900182723 1:1319412-1319434 GGCCATCTGCCCCATCTTGCTGG - Exonic
901921236 1:12539330-12539352 CTCCATGTGGTCTGTCCTGCAGG - Intergenic
903849002 1:26295225-26295247 GGCCTTGTGGGTCATCCTGGAGG - Intronic
908177424 1:61569520-61569542 GGTCATGCCCTCCATCCTGCGGG + Intergenic
908257644 1:62316153-62316175 GGCCATGTGGGCCAGACTGGGGG - Intronic
908391799 1:63689902-63689924 AAGCATGTGGTCCATCCAGCAGG - Intergenic
916809242 1:168291208-168291230 TGCCATGTACTCCCTCCTGCTGG + Exonic
917567986 1:176231743-176231765 GGCCAAGTGGTTCAACCAGCTGG - Intergenic
924331667 1:242946230-242946252 GGCCATGGGGGCCACCCTGCTGG - Intergenic
924813776 1:247425416-247425438 AACCATGTGGTCCATTCTGGTGG - Exonic
1063598730 10:7461247-7461269 CGCCATGTTACCCATCCTGCTGG - Intergenic
1064951643 10:20857657-20857679 GCCCACGTGGTCAGTCCTGCAGG - Intronic
1069622815 10:69848175-69848197 GGCCATCTGATCCATCTTCCTGG - Intronic
1069816908 10:71202554-71202576 GGCTATGCGTTCCAGCCTGCAGG + Intergenic
1070374610 10:75817411-75817433 GGTCATGTGGTCTAATCTGCTGG - Intronic
1070427640 10:76304832-76304854 GGCACTGTGCCCCATCCTGCTGG - Intronic
1071572825 10:86707530-86707552 GGCCATGTGGCGCATCAGGCTGG + Intronic
1073070631 10:100791085-100791107 AGCCCTGTGGCCCATCCTCCAGG + Intronic
1075571335 10:123548518-123548540 GGCCAAGGGTTCCATCCTGCTGG + Intergenic
1076759801 10:132597726-132597748 GGGCCTGTGGTGCGTCCTGCGGG + Intronic
1076759836 10:132597910-132597932 GGGCCTGTGGTGCGTCCTGCGGG + Intronic
1077529094 11:3086796-3086818 GGCCAGGTGGTCCAGCCAGGGGG + Intergenic
1084773017 11:71356686-71356708 GGGCATGGGGTCCATCCTCCAGG + Intergenic
1085293693 11:75418217-75418239 GGCCATGTGATCCATCTGGCTGG + Intronic
1089918073 11:122178829-122178851 GGACAAGTTGGCCATCCTGCAGG + Intergenic
1090389759 11:126381316-126381338 GCCCATTTTCTCCATCCTGCAGG - Intronic
1090740416 11:129654573-129654595 GGCCATGGGGGCCACCCTACTGG - Intergenic
1092052137 12:5479485-5479507 AGGCATGTGGTCCACCCTGCTGG + Intronic
1096560558 12:52433195-52433217 GACCAAGTGGGCCCTCCTGCAGG - Exonic
1098967778 12:76810995-76811017 GTCCATGTGGTCTTTCCAGCAGG + Intronic
1099224035 12:79948095-79948117 CGCACTGTGGGCCATCCTGCAGG - Intergenic
1099684327 12:85866029-85866051 GACCAAGTGGTCCAGCCTCCCGG + Intergenic
1100868845 12:98888796-98888818 GGCCATGAAGGCCATCCAGCAGG - Intronic
1101539750 12:105654122-105654144 GAAGATGTGGTCCATCCTCCTGG + Intergenic
1104194386 12:126519039-126519061 GGCCATGAGGTCGAGGCTGCAGG - Intergenic
1104898201 12:132174412-132174434 TGGCATGTGGACCACCCTGCAGG + Intergenic
1104937657 12:132375157-132375179 GGCCAGGAGGTCCAACCTGGCGG - Intergenic
1106438408 13:29743906-29743928 GTTCATGTGGTCCAGCCTCCAGG + Intergenic
1106675424 13:31953100-31953122 GGCCAAGTCCTCCATCCTGCTGG + Intergenic
1106777547 13:33023236-33023258 GGCAATGTGGTAGAGCCTGCTGG - Intronic
1107819356 13:44272270-44272292 AGCCATTTGCTCAATCCTGCAGG + Intergenic
1111853587 13:93607798-93607820 GGGCATGTGCTCCATCTTTCTGG + Intronic
1113533684 13:111047548-111047570 GGCGAGGTGGCCCAGCCTGCGGG - Intergenic
1115390375 14:32847732-32847754 GGCCCTGTGGTCCCTCCTGGGGG + Intergenic
1116402555 14:44526386-44526408 GTCCATTTGGCCCATACTGCTGG - Intergenic
1118962327 14:70545843-70545865 GTCCATTTGATCCATACTGCAGG - Intergenic
1122123598 14:99567471-99567493 GGCCCAGGGGTCCCTCCTGCTGG - Intronic
1122248670 14:100422814-100422836 GGCCCTGTGCTCCATCCTGGGGG + Intronic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1123991462 15:25686799-25686821 GGCCATGTGGTCCATCCTGCAGG + Intronic
1128397963 15:67248333-67248355 GCCCTTGTGGTACATCTTGCTGG + Intronic
1128446327 15:67764503-67764525 GGCCACTTCCTCCATCCTGCAGG + Intronic
1128663775 15:69523574-69523596 GGCCATGTGCTGCCCCCTGCAGG - Intergenic
1132739787 16:1405993-1406015 GCCCATGTGGTCCCCCCAGCTGG + Intronic
1132868335 16:2104561-2104583 GGCCATGATGCTCATCCTGCAGG - Exonic
1134523394 16:14928440-14928462 GGCCATGATGCGCATCCTGCAGG + Intronic
1134710988 16:16326924-16326946 GGCCATGATGCGCATCCTGCAGG + Intergenic
1134948595 16:18341685-18341707 GGCCATGATGCGCATCCTGCAGG - Intergenic
1135237170 16:20768023-20768045 GGCCATATGGTCTCTGCTGCAGG - Intronic
1136533037 16:30882653-30882675 GGCTGTGGGCTCCATCCTGCAGG + Intronic
1137361334 16:47818719-47818741 GTCCACTTGCTCCATCCTGCAGG - Intergenic
1138426586 16:56938103-56938125 GGTTATGTGGTCATTCCTGCAGG - Intronic
1139513275 16:67439273-67439295 TGCCATGTGCCCCATCCTGGAGG - Exonic
1139957127 16:70698397-70698419 GGACACGTGGACCCTCCTGCGGG + Intronic
1141134331 16:81455889-81455911 GGCCCTGAGGTCCAGCCTGATGG - Intronic
1141678773 16:85531737-85531759 GGCCATCCGGTCCATCCTGGGGG - Intergenic
1142347108 16:89561025-89561047 GGCCACGTGGTTCAACCAGCCGG + Exonic
1143378873 17:6483429-6483451 GCCCACGGGGTCCATGCTGCAGG + Intronic
1144614319 17:16754737-16754759 GTCCATGTGGTCTATAGTGCAGG + Intronic
1144708216 17:17383925-17383947 GGCCACGTGGTTCAACCAGCCGG - Intergenic
1144898388 17:18560940-18560962 GTCCATGTGGTCTATAGTGCAGG - Intergenic
1145133987 17:20384781-20384803 GTCCATGTGGTCTATAGTGCAGG + Intergenic
1145296602 17:21598104-21598126 GGCCAGGTGGTCCAGCCGCCAGG + Intergenic
1145367175 17:22273971-22273993 GGCCAGGTGGTCCAGCCCCCAGG - Intergenic
1146196919 17:30821138-30821160 TGCCATGTTGTCCAGCCTCCTGG - Intronic
1148203161 17:45763295-45763317 GGCTCTGTGCTCCATCCTGGCGG + Intergenic
1148816071 17:50329134-50329156 GGCCAGCTGGTCCATGCTGGGGG + Intergenic
1151041664 17:70868571-70868593 GGCCCTGTAGTGCATACTGCAGG - Intergenic
1152667570 17:81580136-81580158 GGCCGAGTTGTCCATCCTGGAGG - Intronic
1160976312 19:1794456-1794478 TGCCCTGTGCTCCATGCTGCTGG + Intronic
1162478733 19:10915860-10915882 GGCCAAGTGGCCCATCCTGCCGG + Intronic
1162950751 19:14070973-14070995 GGCCAAGTCCTCCATCCTGCTGG + Intergenic
1163495787 19:17645923-17645945 CCCCATGTGGGGCATCCTGCTGG - Intronic
1165245949 19:34498383-34498405 GGCCCTGTGCTCCAAGCTGCTGG - Intronic
1168031210 19:53681406-53681428 TACCCTGTGGTCTATCCTGCAGG + Intergenic
1168048270 19:53809712-53809734 GACCATGTGCTCCATCTTGGAGG + Exonic
926127684 2:10282024-10282046 GCCCAAGTGCTCCTTCCTGCCGG - Intergenic
926330766 2:11823301-11823323 GGCCTTGTAGTCAAGCCTGCAGG + Intronic
927847527 2:26479273-26479295 GGCAATGTGGTCCATGATGTTGG + Exonic
930746353 2:54887068-54887090 GGGGAAGTGGTCCATCCTGGAGG - Intronic
931890080 2:66661926-66661948 GGCCATGGGGGCCACCCTGCTGG + Intergenic
932405919 2:71512613-71512635 CTCCATGTGGTCCAGCCTGCTGG + Intronic
933755215 2:85633038-85633060 GGCCATCTGGTCCCTCCCTCAGG - Intronic
937984068 2:127630716-127630738 GCCCATGAGGCCCTTCCTGCAGG - Intronic
938077428 2:128347125-128347147 AGCCATGTGGTTCGTCCTCCAGG + Intergenic
938108269 2:128547839-128547861 GGCCATGTCATCCCTCCTGGAGG - Intergenic
938663835 2:133513450-133513472 GTCCATGTGGTGCATCCTCCAGG + Intronic
938789378 2:134663309-134663331 GGCCTTGGGGTCCACCCAGCAGG - Intronic
939422054 2:141984085-141984107 GCCCATTTAGTCCAGCCTGCTGG + Intronic
1170401231 20:15985672-15985694 TGCCCTGTGGAGCATCCTGCGGG - Intronic
1172182364 20:33011201-33011223 GGGCATGTGCTCCTGCCTGCTGG + Intronic
1172292701 20:33787856-33787878 GGCAATGCGGTCCACCCTGGGGG - Intronic
1172609607 20:36240195-36240217 GGCCATGAGGGCCAACCTCCAGG + Exonic
1174689606 20:52490820-52490842 GGTCATGTGAACCATCCAGCAGG + Intergenic
1181736627 22:24886665-24886687 GGCCGTGTGGCCCTTCCTCCTGG + Exonic
1182269253 22:29143403-29143425 GGGCCTGTGGTCCTTCCTTCTGG + Intronic
1182362960 22:29758108-29758130 TGCCACGTGGGCCACCCTGCAGG - Intronic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
1185376462 22:50484708-50484730 GGCCAAGTGTTCCCTCCTCCAGG + Exonic
1185394434 22:50579458-50579480 GGGTCTGTGGTCCATCCTCCAGG - Exonic
958580149 3:96007700-96007722 GGCCATGTGGGCCAGCCTCCAGG - Intergenic
961553360 3:127681234-127681256 GACCTTGTGGCCCTTCCTGCAGG + Intergenic
962464923 3:135649230-135649252 GGCCATGGGGGCCATCCCACTGG + Intergenic
963422593 3:145079244-145079266 GGCCATAAGGTCAATACTGCTGG + Intergenic
965805058 3:172533738-172533760 GGCCATGAGGGCCACCCCGCTGG + Intergenic
967825555 3:193874517-193874539 GGCCATAGGGACCATGCTGCAGG + Intergenic
968542996 4:1177788-1177810 GGCCAGGAGCTCCATGCTGCTGG - Intronic
976850784 4:89542278-89542300 GGCCACAGGGTCCAGCCTGCAGG - Intergenic
986787782 5:11130777-11130799 CGCCATATGGTCCATCCCCCGGG + Intronic
988622626 5:32839140-32839162 GGCTGTTTGGTCCAACCTGCAGG + Intergenic
989487681 5:42011075-42011097 GTCCATGTGTTCTATCCTGATGG + Intergenic
992096749 5:73369932-73369954 GCCTAGGTGGTCCATGCTGCTGG + Intergenic
997882594 5:137603765-137603787 GCCCATGTGTTCCATCCCGTTGG - Intergenic
998280082 5:140797255-140797277 GGCCATGAGGTCCGTCTTGGGGG - Exonic
1001455789 5:171858731-171858753 GGCCCTGTGGGCCATTCTGAGGG - Intergenic
1005866192 6:29939218-29939240 AGTCATGTGGACCTTCCTGCAGG - Intergenic
1006576939 6:35053353-35053375 GGACAGGTGGTCCATACTGGGGG + Intronic
1007825348 6:44595731-44595753 GACCATGTGGTCCAGACAGCTGG + Intergenic
1008332405 6:50260373-50260395 GGCCATGGGGCCCACTCTGCTGG + Intergenic
1008688020 6:53945865-53945887 GGCCATGGGGGCCACCCTGCTGG - Intronic
1015029717 6:128580358-128580380 GGCCAAGTCCTCCATCCTGCTGG - Intergenic
1016862059 6:148730864-148730886 GGACATGTGGTGCATCATGGAGG - Intergenic
1018669330 6:166166786-166166808 CGCCATGTACTCCTTCCTGCTGG - Exonic
1019290613 7:248347-248369 GGTCATGTTGACCATCCTGCCGG - Exonic
1020343564 7:7138836-7138858 GGGTATGTGGTCCATCCTTGAGG - Intergenic
1020367357 7:7394621-7394643 GTCCAAGTGGACAATCCTGCTGG - Intronic
1022727707 7:32996106-32996128 GCCCATGTGCTGCAGCCTGCAGG + Intronic
1025045876 7:55691535-55691557 GCCCATGTGCTGCAGCCTGCAGG - Intergenic
1025809287 7:64864102-64864124 GGCCGAGTCGTCCATCCTGCTGG + Intergenic
1026847164 7:73704755-73704777 AGCCAGGTGGCCCCTCCTGCAGG + Intronic
1029162258 7:98560755-98560777 AGCCATGTGGTCTGTCCAGCAGG - Intergenic
1029669342 7:102018405-102018427 GGCCATGAGGACAGTCCTGCAGG + Intronic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1038584326 8:28775852-28775874 GATCATGAGGTCCATCCTGTGGG + Exonic
1041381606 8:57258867-57258889 GGCCCTGCGGTCCTCCCTGCTGG - Intergenic
1041717151 8:60942767-60942789 GGCCCCATGGTCCATCCTCCTGG - Intergenic
1042095373 8:65209983-65210005 AGCCATGTGGTCACACCTGCAGG - Intergenic
1048327135 8:133448452-133448474 GGCCGAGTGCTCCATTCTGCAGG - Intergenic
1048332178 8:133478377-133478399 TGACATGTGGAACATCCTGCTGG + Intronic
1049217044 8:141413026-141413048 GGCCTGATGGTCCCTCCTGCTGG - Intronic
1049422812 8:142524409-142524431 GGCCATGAGGGCCATCCTGAAGG - Intronic
1049617131 8:143580517-143580539 GGCCAAGTCCTCCATCCTGCTGG - Exonic
1049740498 8:144238772-144238794 GGCCTTGGGGTCCTTGCTGCCGG - Exonic
1051275342 9:15393122-15393144 GTCCATGTGTTCCATCCTTCAGG + Intergenic
1055630543 9:78219112-78219134 TGGCTTGTGGGCCATCCTGCTGG - Intergenic
1056709184 9:88976936-88976958 AGACAAGTGGTCCTTCCTGCAGG - Intergenic
1057155680 9:92837068-92837090 GGCCAAGTCCTCCATCCTGCTGG - Intergenic
1057573229 9:96219492-96219514 GGGCTCGTGGCCCATCCTGCAGG - Intergenic
1058888650 9:109342452-109342474 GGCCATGTAGTCCAACCTCAAGG + Intergenic
1061728273 9:132593695-132593717 GGCAAGGTGGGCCTTCCTGCAGG - Exonic
1061788198 9:133043610-133043632 GGCCATGTGGTGGAGGCTGCAGG - Intronic
1061989978 9:134153566-134153588 GGCCATGCGGTCCCTCCCTCAGG - Intronic
1062002252 9:134222198-134222220 TGCCATGGGATCCAACCTGCAGG - Intergenic
1062344957 9:136110359-136110381 GGCCCTGCCGTCCTTCCTGCTGG + Intergenic
1062582344 9:137234146-137234168 GGCCGTGGGCTGCATCCTGCTGG + Exonic
1062628940 9:137455068-137455090 GGCCATGTGGCCCGGGCTGCAGG - Intronic
1189250336 X:39596022-39596044 TGTCAGGTGGCCCATCCTGCAGG + Intergenic
1190177314 X:48161625-48161647 GGCCAGCTGGTCCTTCCTGTTGG - Intergenic
1193300345 X:79881557-79881579 GGCCATGGGGGCCACCCTCCTGG - Intergenic
1195627336 X:107017858-107017880 GGACATCTGGTCCATATTGCTGG - Intergenic
1197404268 X:126030111-126030133 AGCCATGGGGGCCACCCTGCTGG + Intergenic
1199322471 X:146456283-146456305 GGCTATGTGGTTCAACCTACAGG - Intergenic
1201229004 Y:11845395-11845417 GGCCATGGGGGCCACCCTGCTGG - Intergenic