ID: 1123991601

View in Genome Browser
Species Human (GRCh38)
Location 15:25687618-25687640
Sequence CTGAATGAGGCGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 413}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123991601_1123991611 25 Left 1123991601 15:25687618-25687640 CCATCCTCCTTCGCCTCATTCAG 0: 1
1: 0
2: 1
3: 32
4: 413
Right 1123991611 15:25687666-25687688 CCAATCCCAAAACTCTAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123991601 Original CRISPR CTGAATGAGGCGAAGGAGGA TGG (reversed) Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
900709787 1:4106496-4106518 CTGAAAGAGGGCCAGGAGGAGGG + Intergenic
902676983 1:18015595-18015617 CTGATTGAGGCCAAGGAGCAGGG + Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
905487078 1:38308861-38308883 CTAACTGAGGCAAAGGAGAATGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906582609 1:46948709-46948731 ATGAGTGGGGCTAAGGAGGAAGG - Intergenic
906600998 1:47129163-47129185 ATGAGTGGGGCAAAGGAGGAAGG + Intergenic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
909354865 1:74696942-74696964 CTGAATGAGGTCAAAGAGCAGGG + Intergenic
909392131 1:75130971-75130993 CTGTAGGAGGCGGTGGAGGATGG - Intronic
909705052 1:78571636-78571658 GTGAAAGAAGGGAAGGAGGAAGG - Intergenic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912522896 1:110258623-110258645 GTGAATGATTTGAAGGAGGATGG - Intronic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916714551 1:167438382-167438404 CAGAATGGAGCCAAGGAGGAAGG + Intronic
916818089 1:168372604-168372626 CTGACTGAGGAAATGGAGGAGGG + Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917796662 1:178537852-178537874 CTGAAAGAGGCCAAGCAAGAGGG - Intronic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918922107 1:190726318-190726340 CTGAAAGAAGCCAGGGAGGATGG - Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922303639 1:224325326-224325348 CTTAGGGAGGCGAAGGTGGAAGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
924055172 1:240118003-240118025 CTGAATGAGATGAAGGAGTGAGG + Intronic
924744598 1:246819813-246819835 CTTTAGGAGGCCAAGGAGGAGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1064347833 10:14548669-14548691 GCCAATGAGGCGATGGAGGAAGG - Intronic
1064485172 10:15780542-15780564 CTGATTGAGGCCATGGAGGTGGG - Intronic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1068577589 10:58701514-58701536 CTGAACCAGGCAAAGGATGATGG + Intronic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1070537714 10:77392121-77392143 TGGAATGAGGCGAGGAAGGAAGG + Intronic
1072058318 10:91783027-91783049 CAGAATGTGGCCATGGAGGATGG - Intergenic
1072285211 10:93908007-93908029 CTCTATGAGGCAAAAGAGGAGGG - Intronic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1073626635 10:105104493-105104515 TTGCTTGAGGCGAGGGAGGAGGG + Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075071148 10:119320747-119320769 CTGAATGGGACCAAGGAGAACGG + Intronic
1075686411 10:124367885-124367907 GGGAATGAGGCCAAGGAAGATGG + Intergenic
1077302765 11:1854863-1854885 AAGGATGAGGCCAAGGAGGAAGG - Intronic
1077392580 11:2306935-2306957 GGGAAGGAGGAGAAGGAGGAGGG + Intronic
1078637099 11:13062405-13062427 CTTCAGGAGGCCAAGGAGGATGG - Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1081574862 11:44312609-44312631 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
1083431071 11:62613666-62613688 CTGGATGAGGCGCTGGAGGAGGG + Exonic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088056918 11:105594067-105594089 CAGAATGAGTGGAAGAAGGAAGG - Intergenic
1088377984 11:109162672-109162694 TTGAGAGAGGCTAAGGAGGATGG - Intergenic
1088626321 11:111733015-111733037 CTGACTGAGGCGAAGGGGCTGGG + Intronic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089114026 11:116079474-116079496 ATGAATGAGGTGAAGAAGGGAGG - Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092154609 12:6274191-6274213 CTGTTTGGGGCCAAGGAGGAAGG - Intergenic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1094609166 12:31976773-31976795 CTTAACTAGGCGGAGGAGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097638335 12:62148538-62148560 CCAAAAGAGGGGAAGGAGGAAGG + Intronic
1098282962 12:68879981-68880003 CAGAATGAGGTGATGGGGGAAGG + Intronic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101259605 12:103014590-103014612 CTGCATGGGGCTAGGGAGGAGGG + Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102882772 12:116498440-116498462 CTGTAGGAGGCCAAGGAGGGAGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105334231 13:19449922-19449944 CTGAAAGAAGGGAAGGAGAAAGG - Intronic
1105690383 13:22831608-22831630 CTGAATGAGGATAAGGAGTTTGG - Intergenic
1106364725 13:29067373-29067395 GTGTATGAGGCTAAGGAAGAGGG + Intronic
1108628193 13:52253591-52253613 CTGAAAGAAGGGAAGGAGAAAGG - Intergenic
1108657866 13:52552858-52552880 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic
1109393786 13:61726740-61726762 CTCCATGTGTCGAAGGAGGAAGG - Intergenic
1109522136 13:63527523-63527545 CTGAATATGGCCAAGGAAGAAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1112880680 13:104102941-104102963 CTGAATGATGCGAAGGACTCAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1114554124 14:23551710-23551732 GTGAATGAGGCGGAGGAGTGAGG - Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1117009794 14:51459000-51459022 CTGACAGATACGAAGGAGGAGGG - Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118350689 14:64971328-64971350 CTGAGGGAGGCTAAAGAGGATGG - Intronic
1118677150 14:68199636-68199658 CGGAATGAGATGAAGGAGGGAGG - Intronic
1119044011 14:71301512-71301534 CTGGTTGAGGCTACGGAGGAAGG + Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1121617638 14:95323425-95323447 CTTCATGAGGCCAAGGAGGCAGG + Intergenic
1122097062 14:99380054-99380076 CTCACTGCGGCCAAGGAGGACGG - Intergenic
1122337732 14:101004951-101004973 CTTAATGAGTCGCAGGTGGAAGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126671683 15:51121059-51121081 CTGAATGAGGCCAAGGAATCTGG + Intergenic
1126761907 15:51977244-51977266 CTTAGTGAGGCCAAGGTGGATGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128926023 15:71656990-71657012 CTGAATGAGGGGACTGGGGATGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1131215384 15:90530919-90530941 CTGAGTGAGGCAGTGGAGGATGG + Intronic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1134001966 16:10789888-10789910 CTCAAAGAGGGGCAGGAGGAGGG + Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136447184 16:30329618-30329640 CTTTAGGAGGCCAAGGAGGAAGG + Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137677221 16:50309661-50309683 CTGAATGAGGCCACGGAGCCGGG - Intronic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138256581 16:55569066-55569088 CTAAATGAGTCCAAAGAGGAAGG - Intronic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141009808 16:80386999-80387021 CTGAATGACGTGGAGGAGGAGGG - Intergenic
1141350276 16:83288373-83288395 CTACATGAGGTGGAGGAGGAGGG + Intronic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1145789001 17:27613200-27613222 CAGAAGGAGGCCAAGAAGGACGG - Intronic
1145978302 17:28996900-28996922 CTGAAAGAGACAAGGGAGGAGGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146478209 17:33180320-33180342 CACAATGAGGGGAAGGAGCATGG + Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1146645491 17:34574433-34574455 CTGAATGAAGTAAAGGAGCAAGG + Exonic
1147308505 17:39579774-39579796 CTGCATGCGGCGGGGGAGGAGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148910670 17:50940701-50940723 CTGAAAGAAGCAAAGGAGCAAGG - Intergenic
1149388319 17:56164314-56164336 CTGACTGAGACCAAGGAGTAGGG - Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1157813521 18:50715009-50715031 CTGGAAGAGGCGTGGGAGGAAGG + Intronic
1158549943 18:58427140-58427162 CTGAATGAGGCCACTGGGGAGGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1161439399 19:4281994-4282016 CTGAAGTGGGCGAAGGAGGGAGG + Intronic
1163121505 19:15221006-15221028 CTGAATGAGGTTAAGCAGGGAGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1165357115 19:35311086-35311108 CTTTAGGAGGCCAAGGAGGAAGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165763658 19:38336850-38336872 CGGAACGAGGCGGAGGAGCAGGG + Intronic
1165847392 19:38827054-38827076 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
1166290315 19:41859643-41859665 GGGAATGAGGCGCTGGAGGAGGG - Intergenic
1166668240 19:44694405-44694427 CTGAAGGAGGCGACAGAGGAGGG - Intergenic
1166838006 19:45678971-45678993 CCGAATGAGGTGAAGCAGGTTGG - Intronic
1167107114 19:47436826-47436848 CTGTCTGAGGCCAAGGAGGGTGG + Intronic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167342788 19:48925801-48925823 CTTCAGGAGGCCAAGGAGGAAGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927689217 2:25195827-25195849 CTTAATGAGGCGAGGGAGCAAGG - Intergenic
930026184 2:47030421-47030443 CTGAAGGAGGCCAAGGATGCAGG - Intronic
931228581 2:60354761-60354783 CTGAATGAGGCTTGGAAGGATGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933641840 2:84770737-84770759 CTGTAGGAGGCCAAGGTGGAAGG + Intronic
934613680 2:95758432-95758454 CTGAGTGAGGCTGAGGAGCAGGG + Intergenic
934840595 2:97621803-97621825 CTGAGTGAGGCTGAGGAGCAGGG - Intergenic
935590106 2:104839191-104839213 AAGAAAGAGGCGAAGGAGGGAGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937645838 2:124265274-124265296 AGGAATGAGGCGAATGAGCAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
939427974 2:142065413-142065435 CAGAATGAGGCCAAGCAGGAAGG - Intronic
940473926 2:154135717-154135739 CTCAAGGAGGCTAAGGAGGGAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942487859 2:176458086-176458108 ATGAATGGGGCAAAGGGGGAAGG + Intergenic
943877070 2:193081368-193081390 CTGATGGAGGCCAAGGAGAAGGG - Intergenic
944709906 2:202326518-202326540 CTGAATGAGGTGCAGGAGATGGG - Intergenic
946200609 2:218068821-218068843 CTGACTGAGGTGGAGAAGGAAGG + Intronic
946427723 2:219608334-219608356 GGGAAGGAGGAGAAGGAGGAGGG + Exonic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1170360426 20:15540191-15540213 TTGAATGTGGGGAAGTAGGATGG + Intronic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171097491 20:22345614-22345636 CTGAATAAGGCCAAGAAGCAAGG - Intergenic
1172437327 20:34938621-34938643 CAAAAAGAGGCGGAGGAGGAAGG + Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1176738827 21:10578737-10578759 CTGAAAGAAGGGAAGGAGAAAGG + Intronic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178878321 21:36429438-36429460 CTGAGTGAGACGAAGCACGATGG - Intergenic
1179539657 21:42075982-42076004 CTGAAAGAGGCCAAGCAAGAAGG - Intronic
1179542606 21:42093460-42093482 CTTTGTGAGGCCAAGGAGGAAGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182787390 22:32919108-32919130 CCAAATGAGGGGAAGGAGAAAGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
950431015 3:12951177-12951199 CTTTAGGAGGCCAAGGAGGATGG + Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953618237 3:44510784-44510806 CGGAAGGAGGCGAAGGATGCTGG - Intergenic
953672409 3:44974624-44974646 CTGAAAGAGGTGAAGCCGGAAGG - Intronic
954219060 3:49141588-49141610 GTGAGTGAGGCATAGGAGGAGGG - Intergenic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957518176 3:81283264-81283286 CTTAAGGAGGCAAAGGTGGATGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
958972587 3:100628848-100628870 ATGACTGAGGCTAAGGGGGAAGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961802478 3:129462541-129462563 CTGAAGGAGGCCCAGGAGGAAGG + Intronic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
963062993 3:141240419-141240441 CTGAGTGAGGCAAAGGAGCATGG - Intronic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
964763166 3:160153407-160153429 CTGAGGGAGGCCAAGAAGGATGG - Intergenic
965276863 3:166694900-166694922 CTTAAGGAGGCCAAGGTGGATGG - Intergenic
966711876 3:182980303-182980325 CGGGAAGGGGCGAAGGAGGAAGG + Intronic
967694350 3:192514571-192514593 CTGAATGAAGCAGAGGAGGGCGG + Intronic
967818347 3:193817435-193817457 CTCAATGAGGGGAAGCACGAGGG - Intergenic
967867087 3:194198997-194199019 CAGAAAGAGGCTATGGAGGAGGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968887840 4:3344813-3344835 CTTACTGGGGCCAAGGAGGATGG + Intronic
969156277 4:5213172-5213194 CTCAATGAGGTGATGGATGAGGG - Intronic
969278323 4:6152047-6152069 AGGAAGCAGGCGAAGGAGGAAGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
970023641 4:11596891-11596913 AGGAATGAGGTCAAGGAGGAGGG - Intergenic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974558112 4:63478613-63478635 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
977044821 4:92055996-92056018 CTGTAGGAGGCCAAGGTGGACGG + Intergenic
977805155 4:101288592-101288614 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
982205873 4:152996783-152996805 CTGAAGGAGGCCAGGAAGGAAGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
983830332 4:172318755-172318777 CTGAATGAGGACAAGGATAAGGG + Intronic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988388294 5:30594939-30594961 CTTAATGAGGCGAGGGAAGTTGG - Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995191815 5:109325874-109325896 CTGAAGGATGCTAAGAAGGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997160674 5:131606117-131606139 CTGTATGAGGCCAAGGTGGGTGG + Intronic
997690323 5:135823694-135823716 CTGAATGAGGGGTATGAGGGTGG + Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998444691 5:142189482-142189504 CTGAATGAAGTGACAGAGGAAGG - Intergenic
999406785 5:151313593-151313615 CTCAATGAAGGAAAGGAGGAAGG + Intergenic
1000027817 5:157375373-157375395 CAGAATGAGGCCAAGGGGAAGGG + Intronic
1000198985 5:158988893-158988915 CTGAATGAGGCAAAGAGTGAAGG - Intronic
1000925616 5:167190382-167190404 CTCAATGAGGCTTAGGAAGAGGG - Intergenic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004258235 6:14084703-14084725 ATGAATGAGACAAAGGAGGTGGG + Intergenic
1004643654 6:17539334-17539356 CTGGAGGAGGCAGAGGAGGAGGG - Exonic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007783246 6:44265800-44265822 ATGAATGGAGTGAAGGAGGAAGG - Intergenic
1007785888 6:44279121-44279143 ATGAATCAGCCCAAGGAGGATGG + Exonic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1011822915 6:91273805-91273827 ATGAATTAGGCGAAGGAGCCAGG + Intergenic
1013412874 6:109897426-109897448 CTGAGTGAGGCTAAGCTGGAGGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015750774 6:136556255-136556277 CTTTAGGAGGCTAAGGAGGACGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017055763 6:150434356-150434378 ATGAATGAGTCGGAGGAGGTAGG + Intergenic
1017726903 6:157282589-157282611 CTGGAAGAGGCCAAAGAGGAAGG - Intergenic
1018415924 6:163601941-163601963 GGGAAAGAGGGGAAGGAGGAGGG + Intergenic
1018697608 6:166402630-166402652 CTGGATGAGGCGACAAAGGAAGG - Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019146228 6:169977125-169977147 CTGAATGAAAGAAAGGAGGAGGG - Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022481005 7:30743032-30743054 AAGAAAGAGGCGCAGGAGGAGGG - Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022846217 7:34212816-34212838 CTGAATTGGGCCAAGGAAGAGGG - Intergenic
1023754959 7:43407794-43407816 ATGAATGGAGGGAAGGAGGAGGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024720540 7:52132707-52132729 CTGACAGAAGCAAAGGAGGAAGG - Intergenic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1028081493 7:86583586-86583608 CTCTATGAGGCAAAGGAGAATGG - Intergenic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029361350 7:100090528-100090550 GAGAATGAGGGGAAGGAGAAAGG + Intronic
1030100956 7:105944749-105944771 GTGAATGAGGTGCATGAGGATGG - Intronic
1030367686 7:108663934-108663956 TTGAATGAAGCGAAGGACGGAGG - Intergenic
1030835394 7:114277769-114277791 CAGAAAGAGGCGGAGGTGGATGG + Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1033182366 7:139193384-139193406 GTGATTGTGGTGAAGGAGGAAGG + Intergenic
1034073341 7:148208825-148208847 CTGAATGAGGCCAAGGAAAAAGG - Intronic
1034374470 7:150630274-150630296 CTGAGTGAGGCAATGGAAGAAGG + Intronic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035525679 8:311359-311381 CTGAATGATGGAAAGAAGGAAGG - Intergenic
1036194917 8:6706017-6706039 CTTCAGGAGGCCAAGGAGGAAGG - Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044553770 8:93540054-93540076 GTTTATGAGGCGAAGAAGGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044957658 8:97498257-97498279 CTCAATGACGCCAGGGAGGAAGG - Intergenic
1044959648 8:97517890-97517912 CTGTAGGAGGCCAAGGTGGAAGG + Intergenic
1045157874 8:99499009-99499031 CTGAAGCAGGCCAAGGATGAAGG + Intronic
1045311566 8:101007766-101007788 GTGAATCAGGCAAAGGAAGAGGG - Intergenic
1046506505 8:115144708-115144730 CTGAAAGAGGGAAAGGAAGAGGG - Intergenic
1047274431 8:123395280-123395302 CTGAAAGAGGCCTAGGTGGAGGG - Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048152114 8:131904193-131904215 CGGAACGAGGCGAAGGGCGAAGG - Exonic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049217141 8:141413378-141413400 CTAAATGGGGCCCAGGAGGAAGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049570717 8:143369131-143369153 CCGAATGAGACGTAGGAGGGGGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1058167817 9:101640103-101640125 CTGAAGGAGGCGGGGGAGAAGGG - Intronic
1059072422 9:111152812-111152834 AGGAAGGAGGCGGAGGAGGAGGG + Intergenic
1061015157 9:127977204-127977226 CTGAATGGGGCTGAGGAGGGAGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1195501954 X:105612590-105612612 CTGAAAGAGGCGCTGGAAGAAGG + Intronic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1196052551 X:111321021-111321043 CTGATGGAGGCTAGGGAGGAGGG + Intronic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1197254178 X:124245330-124245352 CTCAATGAGTCACAGGAGGAAGG + Intronic
1198542486 X:137654469-137654491 CTGAATGAAGTAAAGGAGGTGGG - Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200932193 Y:8707102-8707124 CTGTAGGATGCGAAGGAGGCAGG - Intergenic
1200977891 Y:9232056-9232078 GTGGCTGAGGCTAAGGAGGAAGG + Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1202132918 Y:21630853-21630875 GTGACTGAGGCTAAAGAGGAAGG - Intergenic
1202597565 Y:26558267-26558289 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic