ID: 1123994016

View in Genome Browser
Species Human (GRCh38)
Location 15:25705839-25705861
Sequence ATGTATCCATGAGCTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123994015_1123994016 15 Left 1123994015 15:25705801-25705823 CCTGAACATTTATGTGGGCTACT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1123994016 15:25705839-25705861 ATGTATCCATGAGCTCTGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123994016 Original CRISPR ATGTATCCATGAGCTCTGCC AGG Intronic
906707288 1:47904011-47904033 ATGAACCCATGAGCTCATCCTGG + Intronic
907929482 1:58986052-58986074 ACGTATCCAGGATCTCTGCCTGG + Intergenic
912480314 1:109977959-109977981 ACGATTCCAGGAGCTCTGCCTGG - Intergenic
913126492 1:115795167-115795189 TTGTATTAATGACCTCTGCCAGG + Intergenic
916488976 1:165284828-165284850 ATCTCTCCATGTGCTCTTCCTGG - Intronic
921277611 1:213535454-213535476 ATGTATTCATCATATCTGCCTGG + Intergenic
922755202 1:228092712-228092734 AAGTATCCCTGAGATCTGCAAGG + Intronic
923348926 1:233084890-233084912 CTGTCTTGATGAGCTCTGCCTGG - Intronic
924107430 1:240663076-240663098 TTATCTCCAGGAGCTCTGCCAGG - Intergenic
1065467915 10:26045019-26045041 GTGTCTCCATTTGCTCTGCCAGG - Intronic
1072152382 10:92693134-92693156 ATTTACCCTTGAGTTCTGCCTGG - Intronic
1072640584 10:97208194-97208216 GTGGAGCCAAGAGCTCTGCCTGG + Intronic
1072790068 10:98311459-98311481 ATGTGTCCCTGGGCTCTGCTTGG + Intergenic
1074106405 10:110392743-110392765 AGGGGTCCATTAGCTCTGCCAGG - Intergenic
1075389260 10:122080761-122080783 ATGAATGCATGTGCACTGCCTGG + Intronic
1075588148 10:123672102-123672124 ATGAATCCATCTCCTCTGCCTGG - Intronic
1079081036 11:17413908-17413930 ATGCCTCCATGAACTCTGGCTGG - Intronic
1081612385 11:44570385-44570407 GTGTTTCCATGAGCTCTCCTGGG + Intronic
1083459069 11:62798949-62798971 AGGTATCCATCAGTTCTGCCAGG + Intronic
1086911252 11:92474971-92474993 ATGTGCCCATGAGGCCTGCCAGG - Intronic
1087865308 11:103219030-103219052 AGGAATCCATGAGCTGTGCCTGG + Intronic
1090003012 11:122978297-122978319 ATGAAATCATTAGCTCTGCCAGG - Intronic
1091954396 12:4626338-4626360 CTTTATCCATTATCTCTGCCAGG + Intronic
1102520357 12:113474193-113474215 AAGGATCCTTGAGCTCTGGCAGG + Intergenic
1103366471 12:120387683-120387705 ATGCACCCCTGAGCTCAGCCTGG - Intergenic
1105776873 13:23670498-23670520 ATCTACCTCTGAGCTCTGCCTGG + Intronic
1106285162 13:28312329-28312351 GGGTATCCATGAGCTCTGGTGGG - Intronic
1106296074 13:28414971-28414993 ATGGATACATGGGATCTGCCAGG + Intronic
1106353732 13:28959106-28959128 CTGTATCCATGGGCTCTTCTGGG - Intronic
1108271816 13:48769241-48769263 ATCTATTCAGGAGCTCTCCCTGG + Intergenic
1111102714 13:83608478-83608500 ATGGTTCCATGAGCTGTGCTTGG - Intergenic
1118905811 14:70022440-70022462 ATGTATTCACCAGCACTGCCAGG - Intronic
1120677694 14:87440833-87440855 TTGTATCTATGAGCTTTGCATGG + Intergenic
1121305986 14:92907186-92907208 ATCTGGCCATGGGCTCTGCCCGG + Intergenic
1121578162 14:95005863-95005885 ATGAATCCATGTGATGTGCCAGG + Intergenic
1123994016 15:25705839-25705861 ATGTATCCATGAGCTCTGCCAGG + Intronic
1129561492 15:76575571-76575593 ATGTATGCATGAGTTCTTTCTGG + Intronic
1130713974 15:86313602-86313624 ATGTATCCAACAGTTCAGCCTGG + Intronic
1130843740 15:87725271-87725293 ACGGACCCAGGAGCTCTGCCTGG - Intergenic
1131167419 15:90152487-90152509 CTGTGTGCATGAGCTTTGCCAGG + Intergenic
1131963290 15:97810875-97810897 AGGTTTCCATGAGCTCAGCTGGG - Intergenic
1136025312 16:27464762-27464784 TGGTAGCCATGGGCTCTGCCTGG - Exonic
1140006033 16:71076001-71076023 ATGTATCCATGTGTAATGCCTGG - Intronic
1141046142 16:80717645-80717667 AAGTATTCATGAGATCTGCTAGG + Intronic
1144258279 17:13491346-13491368 TGGTGTCCATTAGCTCTGCCTGG - Intergenic
1145103578 17:20096821-20096843 GGGTATCCAGGCGCTCTGCCTGG - Intronic
1149078963 17:52631546-52631568 ATGATTCAATGATCTCTGCCAGG - Intergenic
1150120970 17:62602183-62602205 AGGTATCCAGGAGCTCTGCCAGG + Intronic
1151680792 17:75621637-75621659 TTATCTCCTTGAGCTCTGCCTGG + Intergenic
1152632749 17:81417872-81417894 ATGCAGCCATGGGCTCAGCCCGG - Intronic
1153910241 18:9700308-9700330 AGGTACCCATGGGCCCTGCCAGG - Intergenic
1156097610 18:33553843-33553865 ATCTTTCCAGGAGATCTGCCCGG - Intergenic
1161225059 19:3140433-3140455 ATTTATCCCTGACCTTTGCCTGG + Intronic
1163603251 19:18261045-18261067 ATAGATGCATGAGCTCTGCTAGG + Intronic
1163641458 19:18464750-18464772 ATGACTCCTGGAGCTCTGCCTGG + Intronic
925540774 2:4965248-4965270 ATGTATACATGAGCTCTGACTGG - Intergenic
928942578 2:36741659-36741681 TTGGATCCAGGAGCTCTGCCAGG - Intronic
929406104 2:41643272-41643294 TTGTATCCATGATTTCTGTCTGG + Intergenic
932515152 2:72339287-72339309 ATGTATCCATTGGTTCTGCTTGG - Intronic
932586725 2:73034849-73034871 ATGCATCCAGCATCTCTGCCTGG + Intronic
939776231 2:146391814-146391836 GTGTACCCATGAGTTCTGCTAGG + Intergenic
944215459 2:197250289-197250311 ATGTACCCATTACCTCTCCCTGG - Intronic
948173685 2:235927005-235927027 ATGTCTCTATGAGCTCAGCCTGG + Intronic
1170750220 20:19138754-19138776 ATGTTTCAATTATCTCTGCCTGG + Intergenic
1170968456 20:21097221-21097243 ATGTATAAATGAGCTGTGCTGGG - Intergenic
1171268426 20:23793551-23793573 ATACATCCATGCCCTCTGCCAGG - Intergenic
1173742828 20:45413746-45413768 AGGTGACCATGAGCTCTTCCAGG + Intergenic
1174185782 20:48704978-48705000 AAGTATCCAAGAGCTTTGACTGG - Intronic
1177618419 21:23555782-23555804 GTGCAGGCATGAGCTCTGCCTGG + Intergenic
1179547838 21:42124449-42124471 ATGTATCCAAGGGCCATGCCGGG + Intronic
1180650553 22:17372861-17372883 ATAAATCCATGAGTTCAGCCTGG - Intronic
1182370041 22:29804337-29804359 ACGTTTCCATGAGCCCTTCCCGG - Intronic
1183187559 22:36300644-36300666 AGATCTCCATGAGCACTGCCTGG - Intronic
1184209945 22:43029516-43029538 ATGTCTCCATTAGCGTTGCCTGG - Intergenic
1184330155 22:43822059-43822081 AGGTGTCCAGCAGCTCTGCCTGG - Intergenic
950934935 3:16829229-16829251 ATGAATCCCTCGGCTCTGCCTGG - Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954420886 3:50418520-50418542 ATGTCTCCCTGAGCACTCCCAGG + Intronic
956901427 3:73720174-73720196 ATGTACTCATGAGCTCTGCTAGG - Intergenic
958152592 3:89709781-89709803 ATGTATCCATGGGCTGGGCAAGG + Intergenic
959979244 3:112496622-112496644 ATGGAGCCATCAGCTCTGCCTGG + Intronic
960038355 3:113124337-113124359 ATTAATCCATCAGCTCTGCTGGG + Intergenic
963592256 3:147276093-147276115 ACGTATCTATCAGCTCTGCTTGG - Intergenic
964559995 3:157983912-157983934 TTGTAGCCAAGAGCTCTGCAGGG - Intergenic
967077246 3:186014631-186014653 ATGTATCCTTAAGCTCTTCTTGG + Intergenic
969089210 4:4680649-4680671 ATGTACCAATGAGCTCAGCGAGG - Intergenic
973819677 4:54651968-54651990 ATGTTTCCAAGAACTCTACCAGG - Intergenic
975037562 4:69703402-69703424 ATGTATCCCTGAGCTCTGTAAGG - Intergenic
976200038 4:82568780-82568802 ATGTACCCATGAGCCCAGCTGGG + Intergenic
976916895 4:90387361-90387383 ATGTTTCCATAGGCTCTGCATGG - Intronic
984783962 4:183551707-183551729 CTGTAGCCATCAGCTCTGCATGG - Intergenic
985817094 5:2135205-2135227 ATGTGTCCCTGAGCCCTGCAGGG - Intergenic
986021626 5:3809628-3809650 GTGTGTCCATGAGCACTGCCTGG - Intergenic
986803780 5:11288958-11288980 ATGTCCACATGTGCTCTGCCGGG - Intronic
991959221 5:72026584-72026606 ATCTATCCATGAACTCTACTGGG - Intergenic
993352863 5:86871257-86871279 ATATATCCATGATCTCTGGCAGG + Intergenic
993930252 5:93930123-93930145 ATGTATCCAAGATCTCTTACTGG + Intronic
994161793 5:96564932-96564954 AAGTATCTATGAGCTCACCCAGG + Intronic
996706013 5:126499476-126499498 ATCTCTCCCTGGGCTCTGCCTGG + Intergenic
997295178 5:132764495-132764517 ATGGATGCCTGAGCCCTGCCTGG - Intronic
998324961 5:141272192-141272214 ATGTTTCCCTGAGCTCTGTGGGG + Intergenic
1000409767 5:160925964-160925986 ATGTATCCATAAGGATTGCCAGG + Intergenic
1002608909 5:180400985-180401007 ATCTTTCCATGATCACTGCCCGG - Intergenic
1003299298 6:4862383-4862405 ACGTGGCCATCAGCTCTGCCTGG + Intronic
1003432256 6:6050312-6050334 ATGTTTCCATGAGCCCTTCTTGG - Intergenic
1003784505 6:9469734-9469756 ATTTATGCAGGAGCTCTGGCCGG + Intergenic
1005156358 6:22811535-22811557 ATGTAATCATGAGCTCTATCTGG - Intergenic
1005201871 6:23355735-23355757 ATGTCTCTATGATCTCTGCCAGG + Intergenic
1006926254 6:37656947-37656969 CACTATCAATGAGCTCTGCCAGG - Intronic
1007832541 6:44649618-44649640 ATGTCTCCCTGAGCTCTTCTTGG - Intergenic
1008306585 6:49909697-49909719 AAGTATTCATGAACACTGCCAGG - Intergenic
1009515918 6:64617462-64617484 ATGTGTTCATGAACTCTGCATGG - Exonic
1018583792 6:165333836-165333858 ATGTGGCTAAGAGCTCTGCCAGG - Intronic
1021964974 7:25908381-25908403 TTATATGCATGAGCTCTGACTGG + Intergenic
1032546941 7:132751529-132751551 TTGATTTCATGAGCTCTGCCTGG - Intergenic
1036052487 8:5216146-5216168 GAGTATCCATGAACACTGCCTGG + Intergenic
1036052542 8:5216528-5216550 ATCTATCTATGAACACTGCCTGG + Intergenic
1037408079 8:18565123-18565145 ATGTGTCCCTGAGCCCAGCCTGG + Intronic
1037506822 8:19538888-19538910 GTGTGTCCATTTGCTCTGCCTGG + Intronic
1041886930 8:62820547-62820569 CTCCAGCCATGAGCTCTGCCTGG - Intronic
1045497289 8:102719313-102719335 CTTTCTCCATGACCTCTGCCTGG - Intergenic
1049668062 8:143856975-143856997 AAGAATCCATGTGTTCTGCCTGG - Intergenic
1050444407 9:5703440-5703462 ATGAATCCATGGTTTCTGCCTGG - Intronic
1057201765 9:93144257-93144279 ACGTGGCCCTGAGCTCTGCCCGG - Intergenic
1057613831 9:96570414-96570436 ATTTCTCCATTGGCTCTGCCAGG - Intronic
1060519593 9:124286876-124286898 ATGGGTGCATGAGCCCTGCCTGG + Intronic
1190325917 X:49206778-49206800 ATGTATCTCTGAGCTCTGTGAGG + Exonic
1191912295 X:66164047-66164069 ATCTACCCATGAGCTTTGGCTGG + Intronic
1195901044 X:109797596-109797618 CTCTATCAATGAGCTCTTCCAGG + Intergenic