ID: 1123998097

View in Genome Browser
Species Human (GRCh38)
Location 15:25733119-25733141
Sequence CCGGCAGATTTGCTTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123998097_1123998101 -5 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998101 15:25733137-25733159 GCCGGCATTCCTGGGCTCTGTGG 0: 1
1: 0
2: 2
3: 32
4: 529
1123998097_1123998103 3 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998103 15:25733145-25733167 TCCTGGGCTCTGTGGTGTGAAGG 0: 1
1: 0
2: 6
3: 31
4: 359
1123998097_1123998106 12 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998106 15:25733154-25733176 CTGTGGTGTGAAGGAGGTTACGG 0: 1
1: 0
2: 1
3: 20
4: 264
1123998097_1123998107 13 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998107 15:25733155-25733177 TGTGGTGTGAAGGAGGTTACGGG 0: 1
1: 0
2: 0
3: 8
4: 192
1123998097_1123998108 14 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG 0: 1
1: 0
2: 0
3: 10
4: 88
1123998097_1123998105 6 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998105 15:25733148-25733170 TGGGCTCTGTGGTGTGAAGGAGG 0: 1
1: 0
2: 2
3: 39
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123998097 Original CRISPR CCGGCAGATTTGCTTCTTTT AGG (reversed) Intronic
903826725 1:26150959-26150981 CCGGCCTATTTACTTATTTTTGG - Intergenic
905679458 1:39857355-39857377 CCGGCAGATTCTCTGCTCTTGGG + Exonic
907076139 1:51580794-51580816 ACTGCCTATTTGCTTCTTTTAGG - Intronic
907178719 1:52552189-52552211 CCCGCTGATGTGCTTCTTTCAGG + Intronic
917450662 1:175144967-175144989 CTGGCAGATTTGGTTCTTGGTGG + Intronic
917511308 1:175671346-175671368 CAGGCAGACTTGCTGCCTTTTGG + Intronic
917694589 1:177508840-177508862 TCAGTAGATTTGCTTCCTTTAGG - Intergenic
918471125 1:184875548-184875570 CAGGCAGAAATGATTCTTTTTGG + Intronic
923570219 1:235106947-235106969 CTGCCAGGTTTGCTTTTTTTTGG + Intergenic
924172202 1:241355067-241355089 CTTGCAGAGTTGCTTTTTTTTGG - Intronic
924548426 1:245051844-245051866 GAGGGAGATTTGCTTCTTTGAGG + Intronic
1063242422 10:4184883-4184905 CCAGCAGATTTCCTTCTGTTTGG - Intergenic
1063616046 10:7601382-7601404 CTGGAAGATTTGCTTCTGTGAGG - Intronic
1068666335 10:59679516-59679538 CAAGCAGAATTTCTTCTTTTGGG + Intronic
1069635065 10:69920037-69920059 CCTGCAGATGTGCTTAGTTTGGG - Intronic
1072546022 10:96439828-96439850 CCCGCAGATGTGTTTCTGTTTGG + Intronic
1074137538 10:110641108-110641130 CCTGCAGTCTTGCTTCTTTCTGG + Intergenic
1074267240 10:111916689-111916711 CTGGCAGCTTTTTTTCTTTTTGG + Intergenic
1074381644 10:112985659-112985681 CTGGCAGCCTTGCTTTTTTTTGG + Intronic
1075096376 10:119474248-119474270 CAGCCAGATTTGCTTCCTTCTGG + Intergenic
1080410876 11:32023728-32023750 CAGACAGAATTGCTCCTTTTTGG + Intronic
1085486427 11:76867549-76867571 CAGGCACATTTGTTTCTTTCAGG + Intronic
1086851347 11:91812861-91812883 CCTGCTGCTTTGCTACTTTTAGG + Intergenic
1088458271 11:110055570-110055592 CCTGCATCTTTGCTTATTTTAGG - Intergenic
1090840706 11:130485934-130485956 CCAAGAGATTGGCTTCTTTTTGG + Intergenic
1094542427 12:31373524-31373546 CTGGCAGATTTATTTCTTTCAGG + Intergenic
1103639097 12:122334267-122334289 GCGGCAGACCTGCTTCTTTCAGG - Intronic
1104182827 12:126399070-126399092 GAGGCAGATCTGCTTCTTCTGGG - Intergenic
1105327200 13:19381437-19381459 CCAGCAGATTTTCTTCTTCTGGG + Intergenic
1105864449 13:24446908-24446930 CCAGCAGATTTTCTTCTTCTGGG - Intronic
1106900758 13:34352750-34352772 CCAGCAGATTTGATTCCTTTGGG + Intergenic
1114197926 14:20495416-20495438 CAGGCAGTTTTGTTTCATTTTGG - Intergenic
1116352727 14:43885760-43885782 AATGCAGATTTGCTCCTTTTAGG - Intergenic
1118943168 14:70357504-70357526 CTGGCAGATTTGTTGGTTTTGGG + Intronic
1120112126 14:80569877-80569899 CTGGCTCATTTCCTTCTTTTAGG - Intronic
1121194923 14:92062093-92062115 CCGGCAGATTTTTGTATTTTTGG - Exonic
1121555066 14:94830160-94830182 GAGGCAGAATTTCTTCTTTTTGG - Intergenic
1123998097 15:25733119-25733141 CCGGCAGATTTGCTTCTTTTAGG - Intronic
1125015587 15:34931130-34931152 CCGGCTGTGCTGCTTCTTTTAGG + Intronic
1128284870 15:66428468-66428490 CCAGCAGAATTCCTTCTTTTGGG + Intronic
1128646984 15:69384830-69384852 CCGGCACATTTGCTACTTCCTGG + Exonic
1129700827 15:77767921-77767943 CTGGCTTATTTGCTGCTTTTTGG - Intronic
1130107450 15:80939500-80939522 CATGCAGATTTTCTTCTTTCCGG + Intronic
1133060320 16:3170681-3170703 CCGGCCGTTTTTCTTCTTTTAGG - Intergenic
1133499166 16:6348943-6348965 GAGGCAGATTTGCTCATTTTTGG + Intronic
1136450123 16:30349772-30349794 CCTCTAGATTTGCTTCTTCTGGG - Intergenic
1137268220 16:46885499-46885521 TCGGCAGAATTCCTTCCTTTAGG + Intronic
1138277326 16:55745006-55745028 CAGGGTGATGTGCTTCTTTTTGG - Intergenic
1138285730 16:55808430-55808452 CAGGCTGATGTGCTTCTTGTTGG + Intronic
1139507743 16:67407686-67407708 CCAGCACATTTGCTGCCTTTGGG - Intronic
1140854946 16:78969786-78969808 TCTGCAGATTTGCCTCTTTGGGG - Intronic
1141307944 16:82884243-82884265 CCTGCAGATTTCCTTCTCATGGG - Intronic
1144125469 17:12198760-12198782 CCGTCAGATCTGCTGATTTTCGG - Intergenic
1146265558 17:31450504-31450526 CCGGCTAATTTGCATATTTTTGG + Intronic
1146550273 17:33774859-33774881 TCAGCAAATTTACTTCTTTTCGG + Intronic
1147544571 17:41390811-41390833 TCGGCATATTTGATACTTTTTGG - Intronic
1150869129 17:68885315-68885337 CCTTCATATTTGCTTCTTTTAGG - Exonic
1158159920 18:54469322-54469344 CCGGCAGATTGTGTTCTTATAGG + Intergenic
1159526869 18:69603473-69603495 CCGGCAGATGTCCATATTTTAGG - Intronic
1166332225 19:42085258-42085280 CCGGCATTTTTGTTTGTTTTTGG + Intergenic
1167230706 19:48281317-48281339 GCGGCAGAGTTGCTTCCTTCTGG + Intronic
1168354685 19:55693833-55693855 CATGCAGTTTTCCTTCTTTTAGG + Intronic
1168427011 19:56246880-56246902 GCGTCTGGTTTGCTTCTTTTGGG - Exonic
925572008 2:5322533-5322555 CCTGAAGATTTGCTTCCATTTGG - Intergenic
927883186 2:26703174-26703196 CAGGCAGAATTTCTTCTTTGAGG + Intronic
930185462 2:48408327-48408349 ACGGCAGATTTGCCTGTATTTGG + Intergenic
935420371 2:102862286-102862308 CTGGCAGATTTGGTTCTTGATGG + Intergenic
937708448 2:124949380-124949402 CTGGCAGAATTTCTTCTTGTTGG - Intergenic
939047823 2:137270270-137270292 CCGGCTTATTGGCTTCTGTTTGG - Intronic
946759669 2:222980910-222980932 TGGCAAGATTTGCTTCTTTTTGG + Intergenic
948291744 2:236830612-236830634 CTGGGAGAATTGGTTCTTTTGGG + Intergenic
1169802743 20:9527686-9527708 CAGGCTCATTTGCTTCTTGTGGG - Intronic
1170054246 20:12181900-12181922 CTGCCAAATTTGCCTCTTTTAGG - Intergenic
1171064054 20:21995730-21995752 AGGGCAGATTTGCTTTCTTTAGG - Intergenic
1179570302 21:42274634-42274656 CCGGCTGATTTGTGTATTTTTGG + Intronic
1184539146 22:45108228-45108250 CATGCAGATTTGCTTCTGGTTGG - Intergenic
1184714981 22:46276280-46276302 CAGGCAGAATTTCTTCTTCTAGG + Intronic
952171130 3:30808054-30808076 CAGTCTGATTTGCTTCCTTTTGG - Intronic
954742335 3:52763483-52763505 GCGGCAAATCTCCTTCTTTTTGG - Exonic
958899552 3:99869859-99869881 CTGGCAGATTTGCTTCTGTCAGG + Intronic
958992387 3:100861930-100861952 AGGGAATATTTGCTTCTTTTTGG - Intronic
961117132 3:124340134-124340156 ACGGCATATTTGCTTGGTTTGGG - Intronic
963248114 3:143081748-143081770 TGGGCAGATTTGGTTTTTTTGGG - Intergenic
965569284 3:170155099-170155121 CTGGCAGACTTGTTTCTTTCTGG - Intronic
973843413 4:54886234-54886256 CCAGCAGGTTTGATTCTTTCTGG + Intergenic
980247358 4:130265158-130265180 CTGGCAACTTTTCTTCTTTTAGG + Intergenic
981988817 4:150891029-150891051 TTGGCAGATTTTTTTCTTTTTGG - Intronic
982678970 4:158407497-158407519 TCTGCTGATTTGCTTCTTTGGGG - Intronic
984412857 4:179417415-179417437 CCTGCAGATGTGCTTGTTTCTGG + Intergenic
989188296 5:38645619-38645641 CTGGCACATTTGCTTCAGTTAGG - Intergenic
991457977 5:66824572-66824594 TCGGAAGATTTGCTTACTTTGGG + Intronic
991633798 5:68682693-68682715 CCGGCAGATGTGACTTTTTTAGG + Intergenic
994773334 5:104011716-104011738 CATGCAGATTGGCTGCTTTTTGG + Intergenic
998219009 5:140260625-140260647 TCTGCAGATTTGCCTGTTTTGGG - Intronic
1001013806 5:168122541-168122563 CCTTCAGATTTGCTCCATTTAGG - Intronic
1005178283 6:23073171-23073193 CCTGAAGTTTTCCTTCTTTTTGG + Intergenic
1008005888 6:46408607-46408629 CTGGCAGCTTTGCTCCGTTTGGG - Intronic
1010034568 6:71309837-71309859 CAGGCAGTTTGGCTTCTTGTGGG + Intergenic
1010052409 6:71522632-71522654 CCAGCAGGTTTGGTTGTTTTTGG + Intergenic
1011752914 6:90471520-90471542 CTGGCAGAGTTGGTTCTTATTGG + Intergenic
1013988889 6:116229970-116229992 CCGGCATGTTTGGTTGTTTTTGG - Intronic
1016507768 6:144803069-144803091 CTGCCAGAGTTGTTTCTTTTCGG + Exonic
1018061764 6:160095184-160095206 CCTGCAGATTTGCTTAGTCTTGG + Intronic
1018356989 6:163028096-163028118 CCGGCAGAGGTGGTTCATTTGGG + Intronic
1019944993 7:4320591-4320613 TCTACAGATTTGCTTGTTTTAGG + Intergenic
1028184577 7:87767981-87768003 CCAGCAGAGTTGTTTGTTTTCGG - Intronic
1028340811 7:89717846-89717868 ACTGGAGATTTGCTTCTTTTAGG + Intergenic
1030726664 7:112934366-112934388 CAGGCAGATTGGCTTGTTATAGG - Intronic
1030781557 7:113607043-113607065 CCTGCAGAAGTGCTTCATTTTGG + Intergenic
1034881974 7:154769751-154769773 TTGGCAGGTTTACTTCTTTTAGG + Intronic
1037843218 8:22260391-22260413 CCAGCAGATTTTTTTATTTTTGG - Intergenic
1039271185 8:35882558-35882580 CAGGCTGATTTGGTTCCTTTGGG - Intergenic
1041628415 8:60057724-60057746 CCTGTTCATTTGCTTCTTTTGGG + Intergenic
1045236765 8:100358961-100358983 CCGGCTGATTTTTTTATTTTTGG - Intronic
1045524652 8:102931291-102931313 CTGCCATATTTGCTTCTTTCTGG - Intronic
1059569143 9:115415633-115415655 CCGGCAGGTCTGCTTCCTTTTGG + Intergenic
1060900780 9:127256015-127256037 CCTGCAGATCTACTTCTTTGGGG - Intronic
1061591806 9:131602775-131602797 CCGGCAGACTTGCTTCCTCCTGG + Intronic
1187262928 X:17703953-17703975 CCTGCTGATTTGCTTAGTTTGGG - Intronic
1187703556 X:21987618-21987640 CAGGCAGAATTTTTTCTTTTAGG + Intronic
1197468168 X:126832621-126832643 CCGGCAGAGGTGTTTCTTTTGGG - Intergenic
1199322398 X:146455805-146455827 CAGGCAGATTTCCTTGTATTTGG + Intergenic
1199740883 X:150735173-150735195 CTGGCAGAGTTGGTTCCTTTAGG - Intronic