ID: 1123998102

View in Genome Browser
Species Human (GRCh38)
Location 15:25733138-25733160
Sequence ACCACAGAGCCCAGGAATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 396}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123998102_1123998109 12 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998109 15:25733173-25733195 ACGGGGCAGCAGCTGCCTCATGG 0: 1
1: 0
2: 0
3: 21
4: 287
1123998102_1123998110 15 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998110 15:25733176-25733198 GGGCAGCAGCTGCCTCATGGAGG 0: 1
1: 0
2: 3
3: 38
4: 366
1123998102_1123998108 -5 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG 0: 1
1: 0
2: 0
3: 10
4: 88
1123998102_1123998106 -7 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998106 15:25733154-25733176 CTGTGGTGTGAAGGAGGTTACGG 0: 1
1: 0
2: 1
3: 20
4: 264
1123998102_1123998111 23 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998111 15:25733184-25733206 GCTGCCTCATGGAGGCTGCAAGG 0: 1
1: 1
2: 1
3: 49
4: 325
1123998102_1123998107 -6 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998107 15:25733155-25733177 TGTGGTGTGAAGGAGGTTACGGG 0: 1
1: 0
2: 0
3: 8
4: 192
1123998102_1123998112 26 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998112 15:25733187-25733209 GCCTCATGGAGGCTGCAAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123998102 Original CRISPR ACCACAGAGCCCAGGAATGC CGG (reversed) Intronic
900426655 1:2583461-2583483 ACCAGGCAGCCCAGGGATGCCGG + Intergenic
901732482 1:11290268-11290290 CCCACAGAGGCCAGGAGTTCTGG - Intronic
902598674 1:17526212-17526234 CCCAGGGAGCACAGGAATGCAGG + Intergenic
902772746 1:18655270-18655292 ACTACAGAGCTTAGAAATGCAGG + Intronic
903041758 1:20536037-20536059 AGCAATGAGCCCAGGAACGCAGG + Intergenic
903062510 1:20679641-20679663 ATCCAGGAGCCCAGGAATGCAGG + Intronic
903104216 1:21061005-21061027 ACCATAAACTCCAGGAATGCAGG - Intronic
904328658 1:29744089-29744111 ACCCCACAGCCCAGCAAAGCCGG - Intergenic
904400576 1:30253996-30254018 GACACAGGCCCCAGGAATGCAGG - Intergenic
905180455 1:36162302-36162324 AGCTCAGAGCACAGGAATGTAGG - Intronic
905368973 1:37472670-37472692 ACCAAAGACCCCAGGGAGGCAGG - Intergenic
905411992 1:37776947-37776969 CCCTCAGAGCCCATGAAGGCAGG - Intergenic
906196852 1:43934982-43935004 ACCACAGAGCCGGGGGATGGTGG - Intronic
906422849 1:45685916-45685938 ACCACAGAGAACCGGAAAGCTGG + Intronic
906679201 1:47713688-47713710 TTCACAGAGCCCAGGGATGAAGG + Intergenic
906798754 1:48718284-48718306 TCCACAGGGCCCAGGAGGGCAGG - Intronic
909304854 1:74060959-74060981 ACCACAGACCTCTGGAATTCTGG + Intronic
912095977 1:106144506-106144528 TCCCCAGAGCCCAGCTATGCTGG - Intergenic
912472983 1:109918434-109918456 ACCACAGGGGGCAGGAATGGAGG + Intronic
914741747 1:150471578-150471600 GCCACAGAGCCCAAGAATTTGGG + Exonic
915307480 1:154988898-154988920 ACCCCAGATCTCAGTAATGCAGG + Intronic
916631832 1:166623463-166623485 TTCACAGAGCTCAGGAAAGCAGG - Intergenic
916938283 1:169654061-169654083 AACACAGAGCCCAGTGGTGCTGG - Intergenic
917619156 1:176778062-176778084 AGCACAGAGTCCAGGAAGACTGG + Intronic
917870683 1:179239290-179239312 ACCACAAAGGCCAGGCATGGTGG - Intergenic
918059456 1:181048887-181048909 ACCACAGAACCCAGGAACCGGGG - Intronic
918378823 1:183934890-183934912 AGCACAGAGCCCAGCATTTCTGG - Intronic
918601902 1:186374755-186374777 TCCACAGAGCCCAGGAAGTGAGG + Intronic
919610306 1:199737621-199737643 ACCAAAGAGCCAAAGAATGATGG - Intergenic
919751799 1:201042423-201042445 ATCACAGAGGCCAGGAGTGGTGG - Intronic
919952751 1:202380603-202380625 AAGACAGAGCCAAGGAATGGGGG - Intronic
920216204 1:204363076-204363098 AGGACAGAGCACAGGAGTGCTGG - Intronic
920928843 1:210367963-210367985 ACCCCAGAACCCAGCAAGGCTGG - Intronic
921208530 1:212871484-212871506 TTCACTGAGCCCAGGAATACAGG - Intronic
923267610 1:232329641-232329663 AACACAGAGACTAGCAATGCAGG - Intergenic
923527158 1:234781353-234781375 AGCCCAGAGTCCAGGAATTCAGG - Intergenic
1062930256 10:1348155-1348177 ACCCCAGCCCCCAGCAATGCAGG - Intronic
1062931676 10:1356974-1356996 ACCATAAAGCCCAGGAATCCGGG - Intronic
1063037013 10:2296397-2296419 ACACCAGAGCCCAGGTGTGCTGG + Intergenic
1064477566 10:15707375-15707397 ATCCCAGAGCCAAGGAATGTGGG + Intronic
1064579202 10:16776844-16776866 ATCATAGAGCCAAGGAATGATGG - Intronic
1064579300 10:16777949-16777971 ATCATAGAGCCAAGGAATGATGG - Intronic
1066710429 10:38227614-38227636 GCTACAGAGCCCTGGAAAGCTGG + Intergenic
1066979577 10:42399834-42399856 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1067220307 10:44339417-44339439 ACCACATGGCCCAGGAATCTAGG - Intergenic
1067234936 10:44439442-44439464 AACACAGTGCCCAGGATTGTAGG + Intergenic
1067282485 10:44882940-44882962 GTCACAGAGCCCAGGAGGGCAGG - Intergenic
1067547888 10:47208297-47208319 ACCTCAAACCCCAGGGATGCTGG + Intergenic
1067911654 10:50352237-50352259 ACCCCAGAGCCCAGCTATACAGG + Intronic
1068209397 10:53900738-53900760 AGCACAGAGCCCAGGAGTACAGG + Intronic
1069519690 10:69108771-69108793 AACAAAGAACGCAGGAATGCTGG + Intergenic
1070630729 10:78082613-78082635 AGCACAGAGCAAAGGAAGGCTGG - Intergenic
1070970383 10:80560780-80560802 CTCACAGACCCCAGGAATTCAGG - Intronic
1071753288 10:88505994-88506016 AACACAGACCCCAGGAACTCTGG + Intronic
1072032742 10:91537034-91537056 GCCACAGAGCCCAAGAAGGGAGG + Intergenic
1072663561 10:97378327-97378349 ACCACATAGCCCAGGTGTGTAGG - Intronic
1072892573 10:99337415-99337437 ACCACAGAGTTCAGCATTGCTGG - Intronic
1073100025 10:101001643-101001665 TCCACAGAGCCCAGGCAAGAGGG - Exonic
1073489985 10:103846769-103846791 ACCATGGAGCCCAGGCATCCTGG + Intronic
1074788148 10:116859849-116859871 ACCAAAGAGACCAGGGAGGCAGG + Intronic
1074883956 10:117680210-117680232 AGGACAGAGGCCAGGGATGCTGG + Intergenic
1075708715 10:124518772-124518794 CCCCCACAGCCCACGAATGCAGG + Intronic
1075731361 10:124638673-124638695 AGCAGAGACCCCAGGCATGCTGG + Intronic
1075787801 10:125061723-125061745 ATCTGAGAACCCAGGAATGCAGG - Intronic
1076653176 10:132003941-132003963 AGCACAGAGCCCAGTCCTGCCGG + Intergenic
1076781337 10:132726404-132726426 ACCGCAGAGCTCAGGAAAGGCGG - Intronic
1077167799 11:1151676-1151698 TCCACAGTGCCCAGGCATGCTGG - Intergenic
1077225591 11:1437860-1437882 CCCACACTGCCCAGGAAGGCAGG - Intronic
1077391944 11:2304312-2304334 ACCAGAGGCCCCAGGGATGCTGG + Intronic
1078063460 11:8062599-8062621 ACCCAAGACCCCAGGAAGGCAGG + Intronic
1078098777 11:8316653-8316675 ACCACAGAGCTCAGGAAACGCGG - Intergenic
1078936859 11:15959202-15959224 TCCACAGATGCCAGGAAGGCAGG - Intergenic
1079119481 11:17671753-17671775 ATCTCAGAGTCCAGGAATCCTGG - Intergenic
1080120948 11:28676493-28676515 ACGACAAAGCCCAGGCCTGCTGG - Intergenic
1081347889 11:42012763-42012785 AACTCATAGCCCAGGAAAGCTGG + Intergenic
1081714877 11:45242762-45242784 ACAACAGAACCCAGGAATCCTGG + Exonic
1085393336 11:76193681-76193703 ACAATAGAGCCCAGGACTGTGGG - Intronic
1086051941 11:82602699-82602721 AGCACAGAGACCAGGCATGGTGG + Intergenic
1087012502 11:93527248-93527270 ACCACAGATCCCAGGAACCTGGG + Intronic
1088822408 11:113467688-113467710 GACACAGAGCCCAGGAAACCAGG + Intronic
1089278338 11:117355066-117355088 AGGAAAGAGCCCAGGCATGCTGG + Intronic
1089782768 11:120885135-120885157 ATCAGAGAGCTCAGGCATGCTGG - Intronic
1090105711 11:123852019-123852041 ACCACAGACCTCTGGAATCCTGG - Intergenic
1091233663 11:134004550-134004572 AATACAGAGCCCAGCAAAGCTGG - Intergenic
1091405944 12:209681-209703 ACCACACTGCCCAGGAAGGAGGG + Intronic
1091734568 12:2909269-2909291 AACACAGACCCCACGCATGCAGG - Intronic
1091826404 12:3516032-3516054 ACTCCAGAGCCCAAGAAAGCTGG - Intronic
1092196374 12:6551975-6551997 ACTGCAGGGCCCTGGAATGCCGG - Intronic
1094680318 12:32661597-32661619 ATGACAGAGCCCAGGAAGCCAGG - Intergenic
1094729451 12:33157888-33157910 ACCACTGAGAGCAGGAATACCGG + Intergenic
1096039084 12:48498793-48498815 ACCTCTTAGCCCAGGAATGAAGG - Intergenic
1100454601 12:94740262-94740284 TCCACAGAGGCAGGGAATGCAGG + Intergenic
1100696535 12:97099718-97099740 GCCACAGGGACCAAGAATGCAGG + Intergenic
1101898351 12:108772246-108772268 CCCTCAGAGCCCAGGAGTACAGG + Intergenic
1102956555 12:117062863-117062885 ACCTCAGAGCCCAGGGCTGACGG + Intronic
1103040481 12:117691218-117691240 TCCACAGTGCCCTGGAATCCAGG + Intronic
1103449518 12:121018579-121018601 ACCCCAGAGGCCAGGCATGGTGG + Intergenic
1103838599 12:123844590-123844612 ACCACACTGCCCAGGTTTGCAGG - Intronic
1103923530 12:124411625-124411647 AAACCAGAGCCCAGGAATGCTGG - Intronic
1107429141 13:40323248-40323270 ACATCAGGGCCCAAGAATGCTGG - Intergenic
1108030602 13:46225292-46225314 ACTCCAGATCCCAGGCATGCAGG + Intronic
1108125587 13:47239278-47239300 ACTAAAGAGACCAGGAAAGCAGG + Intergenic
1111083470 13:83342825-83342847 TACACACAGCACAGGAATGCTGG - Intergenic
1111549196 13:89784606-89784628 CCCCAAGAGCACAGGAATGCCGG + Intergenic
1111900462 13:94193411-94193433 AACACAGAGGTCAGGAATGGCGG - Intronic
1111969458 13:94896253-94896275 ACCACTGAGCCGAGGAAGACAGG + Intergenic
1112117101 13:96368087-96368109 CCCACAGAGCCCAGCATTGCTGG + Intronic
1112565418 13:100547797-100547819 ACCCCAGTGCCCAGGCCTGCAGG - Intronic
1112574923 13:100627182-100627204 AGCACAGAGAGCAGGGATGCAGG + Intronic
1112848941 13:103680194-103680216 AAAATAGAGCCCAGGAATCCAGG - Intergenic
1113437912 13:110307425-110307447 CCCAGAGAGCCCAGCAAGGCCGG + Exonic
1115690744 14:35841582-35841604 ACCACATAGCCCAGGCACGGTGG - Intronic
1117293844 14:54360928-54360950 ACCACAGAGCCCAAGGCTTCAGG - Intergenic
1118853535 14:69603642-69603664 AGCACAGAGCACAGGACAGCTGG - Intergenic
1119749644 14:77068223-77068245 ACGACAGGTCCCAGGAAGGCAGG - Intergenic
1121092716 14:91194036-91194058 ACCAGGGAGTCCAGGAAGGCAGG - Intronic
1121494829 14:94385098-94385120 ACCACTGAGCCCTGTAATGATGG - Intronic
1121662265 14:95644232-95644254 ATCACAAAGCCCAGTAAGGCAGG + Intergenic
1121791141 14:96700637-96700659 ACCACTGAGGCCAGGCATGGTGG + Intergenic
1122695945 14:103552189-103552211 GCCACAGAGGCCAGGCAGGCTGG - Intergenic
1122959836 14:105089404-105089426 ACAGCAGAGCCCAGGAAGGAGGG + Intergenic
1123015508 14:105372098-105372120 ACCACAGAGCACTGGCATCCAGG + Intronic
1123998102 15:25733138-25733160 ACCACAGAGCCCAGGAATGCCGG - Intronic
1124018147 15:25895861-25895883 ACCACAGAGCCCAGTGGTGCTGG - Intergenic
1125718162 15:41831312-41831334 CCCACTGGGCCCAGGAATACTGG - Intronic
1125718366 15:41832647-41832669 CCCACTGGGCCCAGGAATACTGG - Intronic
1126979675 15:54227502-54227524 ACCAAAGAGCTCAGGAAGGGAGG - Intronic
1127346056 15:58100264-58100286 ACCACTGGACCCAGGAATCCCGG - Intronic
1127769825 15:62222196-62222218 AGCACAGAGCACAGGATTTCAGG + Intergenic
1129680695 15:77656915-77656937 AGCTCAGAGACCAGGACTGCTGG - Intronic
1129706893 15:77799490-77799512 ACCCCAGGCCCCAGGAATGACGG + Intronic
1131543303 15:93292984-93293006 AGCACAGATTCCAGGAAAGCAGG + Intergenic
1131919871 15:97313584-97313606 TCCACAGAGGCCAGGTTTGCTGG - Intergenic
1132655926 16:1041636-1041658 AGGACAGAGCCCAGGAAAGAAGG - Intergenic
1132749223 16:1449679-1449701 GCCACAGAACCCAGGCATGGAGG + Intronic
1133429788 16:5726476-5726498 ACCACAGAGTGAAGGAAAGCGGG - Intergenic
1134136883 16:11682711-11682733 ACCACATAGTCCAGGAATCACGG - Intronic
1134272631 16:12746741-12746763 AGCACAAAGCACAGGAATGGAGG + Intronic
1134284158 16:12845671-12845693 ACTTCAGAGCCAAGGAAAGCAGG - Intergenic
1135304918 16:21359837-21359859 CCCACAGAGCCCTGCTATGCCGG + Intergenic
1136301667 16:29339030-29339052 CCCACAGAGCCCTGCTATGCCGG + Intergenic
1137063744 16:35815128-35815150 ACAATAGAGCCCAGGCATGGTGG + Intergenic
1138249413 16:55490557-55490579 GCTACAGAGCCCAGGGTTGCAGG + Intronic
1138349929 16:56341050-56341072 TCCACAGAGCACAGGAAGGGTGG - Intronic
1138432185 16:56975996-56976018 ATCACAGAGCCGGGGAAGGCTGG - Intronic
1139380218 16:66525841-66525863 ACCACAGAGGCCATGCATTCTGG + Intronic
1139603120 16:67998579-67998601 ACCACAGGGCTGAGGAGTGCGGG + Intronic
1139943040 16:70619885-70619907 GCCACTGGGCCAAGGAATGCCGG - Intronic
1139943708 16:70624202-70624224 GCCACTGGGCCAAGGAATGCCGG - Intronic
1141311058 16:82913597-82913619 ACCACAGAGGCCAGCAGAGCAGG + Intronic
1141826401 16:86483808-86483830 ACCCCAGAGCCAAGTCATGCTGG + Intergenic
1141991966 16:87615690-87615712 AGAAGGGAGCCCAGGAATGCCGG + Intronic
1142063353 16:88045589-88045611 CCCACAGAGCCCTGCTATGCCGG + Intronic
1142261989 16:89047374-89047396 TCCTCAGAACCCAGGAGTGCCGG + Intergenic
1143356178 17:6330513-6330535 AGCAAGGAGCCCAGGAATCCTGG - Intergenic
1143672479 17:8406044-8406066 ATTACATAGCCCAGGACTGCTGG + Intergenic
1143783555 17:9241455-9241477 TGCAGAGAGCCCAGGAAGGCAGG - Exonic
1144954942 17:19014415-19014437 ACCACAGAGCCAAGGAGAGAGGG + Intronic
1145033381 17:19522441-19522463 ACCACACAGACCAGGCATGGTGG - Intronic
1147315941 17:39620265-39620287 ACCACAGAACTCAGGAATCCTGG + Intergenic
1147582416 17:41634853-41634875 ACCCCAGGGCCCTGGAATGCTGG - Intergenic
1147745795 17:42693649-42693671 AACTCAGAGCTCAGGAATCCAGG - Intronic
1147755225 17:42762950-42762972 ACCACAGATCCCTGGATTGCTGG + Exonic
1147887877 17:43696819-43696841 ACCCCAGGGCCCAGGCAGGCAGG - Intergenic
1147995227 17:44356441-44356463 GCCTCAGTGCCCAGGAAGGCAGG + Exonic
1148476879 17:47934476-47934498 ACTACAGAGGCCAGGCATGGTGG - Intergenic
1148501682 17:48096482-48096504 ACCACAGTGGCCAGGCATGGTGG + Intronic
1148992219 17:51676149-51676171 AGTACAGAGTCCAGCAATGCCGG - Intronic
1149124021 17:53206212-53206234 CCCACAGAGCCCAGGGATTAGGG + Intergenic
1151878986 17:76883536-76883558 ACCTCAGAGAACAGGAGTGCGGG + Intronic
1151911643 17:77087458-77087480 ACCACTGAGGCCAGGCATGGTGG - Intronic
1152096984 17:78278251-78278273 ACCACAGAGCCCAGGCAGCAGGG + Intergenic
1152853986 17:82653484-82653506 ACCACTGAGCCCAGGATTCAAGG + Intergenic
1152895392 17:82907931-82907953 CCCACTGAGCCCAGGACTGATGG - Intronic
1154094130 18:11394611-11394633 ACTGCAGAGCCCAGCAGTGCGGG + Intergenic
1157108694 18:44799411-44799433 ACCCCAGATCACAGAAATGCAGG + Intronic
1157260325 18:46171317-46171339 AGCCCAGAGCCCAGAAATGAGGG + Intergenic
1158812882 18:61058142-61058164 ACCCCACAACCCAGGAAAGCTGG + Intergenic
1159625353 18:70686899-70686921 ACCACAGGCTCCAGCAATGCAGG - Intergenic
1159799834 18:72884311-72884333 GACCCAGAGCCCAGGAATGGGGG + Intergenic
1160037976 18:75319016-75319038 ACCAAAGGGCCGAGGACTGCCGG - Intergenic
1160288196 18:77566700-77566722 CCTTCAGAGCCCAGGACTGCTGG + Intergenic
1160510772 18:79452229-79452251 GCCTCCGACCCCAGGAATGCTGG - Intronic
1160939818 19:1615008-1615030 GCCACAGAGCCCAGGCCTGAAGG + Intronic
1161221107 19:3118676-3118698 ACCACTGGGCCCAGGGAAGCGGG - Intronic
1161608441 19:5227955-5227977 CCCACAGTTCCCAGGCATGCCGG - Intronic
1162182336 19:8878579-8878601 CCCACAGAGCACGGGAAGGCTGG + Intronic
1162525387 19:11203501-11203523 AACCCAGAGCCCAGGCAGGCAGG - Intronic
1162592441 19:11601184-11601206 AGCTCAGAGCCCTGGAAAGCTGG + Intronic
1162615503 19:11797763-11797785 GCTACAGAGCCCTGGAAAGCAGG + Intronic
1162664633 19:12199863-12199885 GCCACAGAGCACTGGAAAGCTGG + Intergenic
1162698669 19:12496874-12496896 GCTACAGAGCACTGGAATGCTGG + Intronic
1162826458 19:13255390-13255412 AAGAGAGAGCCCAGGAATCCTGG - Intronic
1163529458 19:17841354-17841376 GCCACAGAGGCCGGGAATGGGGG + Intronic
1163870531 19:19817551-19817573 GCCACAGAGCCCTGGAAAGCTGG - Intronic
1163884527 19:19954116-19954138 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1163905102 19:20145303-20145325 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1163915039 19:20233787-20233809 ACTGCAGAGCCCTGGAAAGCTGG - Intergenic
1163933667 19:20422747-20422769 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1163948543 19:20563211-20563233 GCTACAGAGCCCTGGAAAGCTGG - Intronic
1163969566 19:20779064-20779086 GCTACAGAGCCCTGGAAAGCTGG + Intronic
1164022821 19:21323736-21323758 GCTACAGAGCCCTGGAAAGCTGG - Intronic
1164042927 19:21509645-21509667 GCTACAGAGCCCTGGAAAGCTGG + Intronic
1164048662 19:21564977-21564999 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1164080055 19:21854489-21854511 GCTACAGAGCCCTGGAAAGCTGG + Intergenic
1164095523 19:22006550-22006572 GCTACAGAGCCCTGGAAAGCTGG - Intronic
1164101383 19:22057448-22057470 GCTACAGAGCCCTGGAAAGCCGG + Intronic
1164114992 19:22211235-22211257 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1164176508 19:22780031-22780053 GCCACAGAACCCTGGAAAGCTGG - Intronic
1164241296 19:23391712-23391734 TCTACAGAGCCCTGGAAAGCTGG - Intronic
1164283824 19:23792377-23792399 ACTACAGAGCCTTGGAATGCTGG + Intronic
1164306627 19:24009641-24009663 GCTACAGAGCCCTGGAAAGCTGG - Intergenic
1164636275 19:29793640-29793662 ATCACAGAACGCAGGAAGGCTGG - Intergenic
1165103913 19:33457422-33457444 CCCACAGTGCTCAGGACTGCAGG - Intronic
1165319420 19:35076232-35076254 GCCACAGAGCCCAGGAGCCCAGG + Intergenic
1166561183 19:43733386-43733408 ACCTCAGAGTCCAGGAAGTCAGG + Exonic
1166906677 19:46115251-46115273 TCCCCAGAGCTCAGGAATTCTGG - Intergenic
1167115956 19:47489206-47489228 ACCACTAAGCCCGGGAATGCTGG + Intronic
1167198873 19:48050205-48050227 ACCACAGAGGCCGGGCATGGTGG - Intronic
1167688015 19:50968689-50968711 GCCGCAGAGCCCAGGGCTGCAGG + Exonic
1167699809 19:51035936-51035958 AGCACAGAGGCCAGGTATGGTGG - Intergenic
1168268031 19:55232951-55232973 ACCACAGAGCCTAGGTGTACAGG - Intronic
925221637 2:2146485-2146507 AGCACTGAGCCCAGGAAGGGAGG - Intronic
925589554 2:5495860-5495882 AACACTGAGCTAAGGAATGCTGG - Intergenic
925679108 2:6398536-6398558 ACCGCAGAGCCCAGGAGCTCTGG + Intergenic
925782851 2:7398820-7398842 ACAGAAGAGCCCAGAAATGCAGG - Intergenic
927007082 2:18861779-18861801 AACACAGAGCCCAGGGCTGAAGG - Intergenic
928770187 2:34696145-34696167 ACCACCGGGCCAAGGAATGCCGG + Intergenic
928866415 2:35922250-35922272 TCCTCAAAGCCCAGGAATGGTGG + Intergenic
928873269 2:36006715-36006737 AACCCTGAGCCAAGGAATGCAGG - Intergenic
930077555 2:47419348-47419370 GCCACTGAGCCCAGCCATGCTGG + Intronic
930657374 2:54019586-54019608 AGCACAGGGGCCAGGAATGGTGG - Intronic
930888729 2:56358207-56358229 ACGACAGATCCCAGGAAACCTGG + Intronic
932506071 2:72233398-72233420 CCCACAGAGCCCAGACAGGCTGG - Intronic
932770390 2:74497893-74497915 GCCCCAGAGCCCAGGATTGGCGG + Exonic
933640182 2:84750470-84750492 ACCACATAGGCCAGGCATGGTGG - Intronic
933986111 2:87593621-87593643 ACCACAAATCCCACGAATGGAGG + Intergenic
935326563 2:101943020-101943042 AGCCCAGAGCCAGGGAATGCAGG + Intergenic
935345076 2:102100252-102100274 AGTACAGAGCAGAGGAATGCAGG - Intronic
935449464 2:103192076-103192098 ACCACACAGGCCAGGCATGGTGG + Intergenic
936307726 2:111357182-111357204 ACCACAAATCCCACGAATGGAGG - Intergenic
936392310 2:112086725-112086747 CCCACAGAGCTGAGGAATGAGGG - Intronic
936579732 2:113687997-113688019 ACCACAGAGGCCAGGAGCGGTGG + Intergenic
936637997 2:114281315-114281337 ACCACAGACCCCAGAAATGCAGG + Intergenic
939149276 2:138454287-138454309 AGCAAAGAACCCAGGGATGCAGG + Intergenic
941957542 2:171219886-171219908 ACCCCAGAGGCCAGGAGTGGTGG - Intronic
942222943 2:173789291-173789313 ACCACAGAGACCACGAATACTGG + Intergenic
943323177 2:186471358-186471380 AACAGAGAGCCCAGAAATGAGGG + Intergenic
944296851 2:198075154-198075176 ACAGCAGGGCCCAGGAATCCTGG - Intronic
944532628 2:200682511-200682533 ACAACAGGGCCTAGGAATGATGG - Intergenic
945292018 2:208136008-208136030 TCCACACAGCCCAGCCATGCTGG + Intergenic
947712496 2:232324021-232324043 ACCGCAGAGCCCTGGGAGGCAGG - Intronic
947839138 2:233196518-233196540 GCCACAGATCCCATGATTGCTGG - Intronic
947955227 2:234184091-234184113 ACCACGAAGCCCAGCAATACAGG + Intergenic
948568108 2:238899059-238899081 AGCAAAGAGGCCAGTAATGCTGG - Intronic
1169961355 20:11163687-11163709 AACACAGAGCTCATGAATCCAGG - Intergenic
1171300509 20:24055674-24055696 ATCAGTGAGCCCATGAATGCAGG - Intergenic
1172225524 20:33302814-33302836 AGCAGGGAGCCCAGGAAGGCAGG + Intronic
1172580766 20:36045538-36045560 ACCTCAGAGCCCAAGCATGAAGG + Intergenic
1172696746 20:36828214-36828236 AACACAGAACCCTGGAATGGGGG + Intronic
1173420340 20:42895537-42895559 ACCCCAGAGGCCAGGAATCTTGG + Intronic
1173653672 20:44684073-44684095 ACCTCTGTGCCCAAGAATGCAGG - Intergenic
1175998152 20:62820515-62820537 ATCACAGAGGGCAGGAAGGCTGG + Intronic
1176023191 20:62972990-62973012 ACCACAGGGCCCAGCAGGGCAGG + Intergenic
1176094480 20:63333638-63333660 GGCACAGCGCCCAGGAAGGCGGG + Intronic
1178037537 21:28601342-28601364 ACCAAAGAGGCCAGTAAGGCTGG - Intergenic
1179948806 21:44698166-44698188 ACCACAGGGGCCTGGAATGTGGG - Intronic
1180064982 21:45407821-45407843 AGCACAGAGCCCAGTGATGTGGG + Intronic
1180065739 21:45411326-45411348 ACCTCAGAGCCCAGGGCTGTGGG + Intronic
1180147327 21:45928691-45928713 GCCACAGAGGCCACCAATGCTGG - Intronic
1180718171 22:17886377-17886399 ACCAGAGAGGCCAGGCATGGTGG + Intronic
1180859342 22:19068335-19068357 AGCACAGAGTCCGGCAATGCAGG + Intronic
1181671471 22:24427424-24427446 GACACAGAGCCCAGGAGTCCTGG - Intronic
1181698471 22:24607089-24607111 CTCACAGAGCCCAGCAGTGCAGG - Intronic
1181858445 22:25799672-25799694 GCCACAGGGCCCGGGAATGTGGG - Intronic
1181875409 22:25936723-25936745 ACAGCAGAACCCAGGCATGCTGG - Intronic
1182896144 22:33860977-33860999 GCGACAGTGCCCAGGAGTGCAGG - Intronic
1184450532 22:44579853-44579875 ACCACAGACCCGATGAATTCAGG - Intergenic
1184974891 22:48054037-48054059 ATCAAAGAGCCCATGAATGTGGG + Intergenic
1185094890 22:48800797-48800819 ACCCCTGAGCCCAGGCATGGAGG + Intronic
1185264023 22:49888776-49888798 TCCAGAGTGCCCAGGAGTGCTGG + Exonic
949921725 3:9008380-9008402 ACCTCAGCCCCCAGGAAGGCAGG + Intronic
952190469 3:31017798-31017820 ACCTATGAGCCCAGGAATACAGG + Intergenic
952920887 3:38283084-38283106 GTCCCAGAGCCAAGGAATGCAGG - Intronic
953636333 3:44668291-44668313 ACCAGAGATCACAGGAATCCTGG - Intergenic
954297932 3:49684522-49684544 AGCACAGTGCACAGGACTGCTGG - Intronic
954689452 3:52388001-52388023 ACAACATAGCCCAGAAAGGCTGG - Intronic
956399963 3:68867249-68867271 ACCACAGAGGCCAGGAAAGATGG + Intronic
959048018 3:101496473-101496495 GCCACAGAGCCCAGGAATTTGGG - Intronic
960060626 3:113317153-113317175 ACCACAGACCTCTGGAATCCTGG + Intronic
960967731 3:123116741-123116763 ACCACAGAGCCTGGGAAGCCGGG - Intronic
961113208 3:124303373-124303395 CCCAGAGAGCTCAGGAAAGCTGG - Intronic
961535197 3:127566436-127566458 ATGACAGGGCCCAGGATTGCAGG + Intergenic
961921548 3:130431725-130431747 ACCACAGAGCCCCGAGATGTTGG + Exonic
962867425 3:139459266-139459288 ATCACAGAGGCCAGGCATGGTGG + Intronic
963474583 3:145789058-145789080 TCCACATAGGCCAGGAATGGTGG + Intergenic
966726688 3:183115090-183115112 ACCAACGTGCCCAGGGATGCCGG + Intronic
967274384 3:187759620-187759642 TCCACAGAGACCAGGCATGGAGG + Intergenic
967387321 3:188924489-188924511 ACTACAGGGTCCAGGAATCCAGG + Intergenic
968929921 4:3573411-3573433 AGCACAGAGGCCAGGAAGGCTGG - Intergenic
970310356 4:14776553-14776575 TCCACAGTGGCCAGGAATGAAGG + Intergenic
971234410 4:24828488-24828510 ACCACAGAGGCCAGGCATGGTGG + Intronic
971248242 4:24949700-24949722 AGCACTGAGGCCAGGAAAGCAGG + Intronic
971510646 4:27418948-27418970 TCCACAAAACCCGGGAATGCTGG - Intergenic
972125381 4:35758768-35758790 ACCACAGAGACAAGGCCTGCAGG + Intergenic
974075335 4:57163814-57163836 ACCGCTGAGCCCAGGAAAGGGGG - Intergenic
975694510 4:76998473-76998495 AGCCAAGAGCCAAGGAATGCAGG - Intronic
976403550 4:84636042-84636064 ACCACAGAGCCCAGGGGCGGTGG - Intronic
976944264 4:90745206-90745228 TCTACAAAGCCCAGTAATGCAGG - Intronic
977171226 4:93765301-93765323 ACAACAGATTCCAGGAATACAGG - Intronic
978329927 4:107601368-107601390 ACCACAGAGCCTGGGAAAGCTGG + Intronic
979645685 4:123065095-123065117 ACCACATAGCCCAGGATTCCAGG + Intronic
980975953 4:139610646-139610668 GGCCCAGAGCCAAGGAATGCAGG + Intergenic
981284424 4:142998880-142998902 AAGACAGAGACCAGGAATCCAGG + Intergenic
981405089 4:144358448-144358470 AACACAGACCCCATAAATGCAGG - Intergenic
981605409 4:146535293-146535315 AACAGGGAGCCAAGGAATGCAGG - Intergenic
981704224 4:147642038-147642060 ACTGCAGAGAGCAGGAATGCAGG - Intronic
981718222 4:147773003-147773025 ACCACTGAACTCTGGAATGCAGG - Intronic
982506304 4:156221755-156221777 ACAAGAGAGCCCAAGTATGCAGG - Intergenic
984158882 4:176226809-176226831 ACCGCAGAGCCCAGGCAAGCTGG - Intronic
985517163 5:353024-353046 ACCACAGAGCCCAGAGAGGGAGG - Intronic
986125080 5:4876952-4876974 TCCACAGAGCCCTGGAGTGCTGG - Intergenic
986176375 5:5355534-5355556 ACCACAGGCCCCAGGGATTCTGG + Intergenic
986398978 5:7361089-7361111 GCCTCTGAGCCAAGGAATGCAGG + Intergenic
987795730 5:22625392-22625414 ACCACAGACCTCTGGAATTCTGG + Intronic
989103635 5:37841054-37841076 TCCACAGAGCTCTGGAATGGGGG - Intergenic
990349620 5:54902924-54902946 ACCACAAAGAACATGAATGCAGG + Intergenic
991081415 5:62604496-62604518 ACCACATAGGCCAGGCATGGTGG - Intronic
992607153 5:78469935-78469957 ACAACACAGCCCAGGCATGGTGG + Intronic
994126100 5:96170298-96170320 GCCACTGGGCCAAGGAATGCCGG - Intergenic
995333865 5:110976463-110976485 TGCACACAGCCCAGGGATGCCGG + Intergenic
997213112 5:132089277-132089299 CCCACAGAGCCCAGATTTGCAGG + Intergenic
997271602 5:132544102-132544124 ACCAAACAGTCCAGGAATGGAGG + Intronic
997278785 5:132623835-132623857 ACCACAGGGCTCAGGAAGACAGG + Intronic
997356509 5:133266185-133266207 AGCACAGAGCCCAGGCGTGGGGG + Intronic
997364887 5:133319389-133319411 CCCACAGTGCCCAGGACTGGAGG - Intronic
997425819 5:133801873-133801895 ACCAGAGAGCACAGGGCTGCTGG - Intergenic
997677246 5:135721954-135721976 GCCACTGAGCCCAGGTATGTGGG + Intergenic
998486996 5:142511625-142511647 ACCTCAGAGAGCAGCAATGCTGG + Intergenic
999636200 5:153625217-153625239 GAAACATAGCCCAGGAATGCTGG + Intronic
1000016850 5:157285500-157285522 ACCAGGGGGCCCAGGAATTCTGG + Intronic
1001398635 5:171433687-171433709 ACCACACAGCCCAGTGAGGCAGG - Intronic
1002898265 6:1391373-1391395 CCCAAAGAGCCCAGGAAGGCAGG - Intronic
1003048893 6:2763333-2763355 ACCCCAGAGCTGAGCAATGCAGG - Intergenic
1003276972 6:4661450-4661472 AGCTCAGAGCCCAGGTATGTTGG - Intergenic
1004217195 6:13713372-13713394 ACAACAGAGGCCAGGCATGGTGG - Intergenic
1006429942 6:33989189-33989211 CCCTAAGAGCCCAGGAATACAGG + Intergenic
1006677978 6:35777355-35777377 GCCAAAGAGCCCAGGGATCCAGG - Intronic
1007316388 6:40992683-40992705 ACCACATAGTCCAGGAACCCTGG - Intergenic
1007407506 6:41643512-41643534 ACCACACAGCACAGGAAGGAGGG + Intronic
1007719361 6:43876161-43876183 ACCTGGGACCCCAGGAATGCAGG - Intergenic
1008498455 6:52156244-52156266 ACCACAAAGCCCACAAAGGCAGG - Intergenic
1010719796 6:79270182-79270204 ACTATAGAGCCAAGGAAAGCAGG + Intergenic
1010941440 6:81922649-81922671 ACCACAGAGGCCAGCAAAGGTGG + Intergenic
1014493702 6:122093172-122093194 ACCACATAGCCCAGGAACAGAGG - Intergenic
1015973084 6:138762336-138762358 ATCACAGAGCCCAGGCATAAAGG + Intronic
1018064797 6:160117397-160117419 ACCACAGAGCCCAGGAGACATGG - Intergenic
1018709095 6:166485110-166485132 CCCACACAGCCCTGGAAGGCAGG - Intronic
1018759250 6:166876645-166876667 AACCCAGAGCCCAGGAAGGAAGG + Intronic
1018843136 6:167532995-167533017 TCCACAGAGGCCAGGAATAAAGG + Intergenic
1018962030 6:168456049-168456071 ACCCCAGAGCCCAGGGAGGGCGG + Intronic
1021969846 7:25954680-25954702 AGGCCAGAGCCAAGGAATGCGGG - Intergenic
1023617040 7:42030151-42030173 ACCCCTGAGCCAAGGAATGTGGG - Intronic
1023852580 7:44158593-44158615 ACCTGAGGGCCCAGGAATGGAGG - Intronic
1023891827 7:44398300-44398322 ACCAGAGAGGCCAGGAATCCAGG - Intronic
1025719046 7:63992617-63992639 GCAACAGAGTCCAGGAAAGCTGG + Intergenic
1025747191 7:64253457-64253479 GCAACAGAGCCCAGGAAAGCTGG + Intronic
1025798556 7:64762387-64762409 GCTACAGAGCCCTGGAAAGCTGG + Intergenic
1025815434 7:64906693-64906715 GCTACAGAGCCCAGGAAAGCTGG + Intronic
1025865535 7:65377393-65377415 GCTACAGAGCCCTGGAAAGCTGG + Intronic
1026854991 7:73747516-73747538 AACACAGAGCCCAGAAAAACAGG + Intergenic
1028222745 7:88216490-88216512 AGCTCAGAGACCAGGAGTGCAGG + Intronic
1031973106 7:128077764-128077786 GCAGCAGGGCCCAGGAATGCTGG - Intronic
1032383884 7:131508252-131508274 AGAAAAGGGCCCAGGAATGCAGG - Intronic
1034345832 7:150384626-150384648 AACACAGAGGACAGGAATGAGGG - Intronic
1034393787 7:150804664-150804686 GTCAAAGAGCCCAGGAATCCAGG + Intronic
1034974119 7:155438074-155438096 ACCACACAGCCCTGGGATGTGGG - Intergenic
1035276053 7:157748556-157748578 ACCCCAGAGCTCAGGGACGCAGG - Intronic
1035426926 7:158784187-158784209 ACCACAGATCCCAGAAAGTCGGG + Intronic
1035675994 8:1455841-1455863 ACCACAGACTCCAGGACGGCAGG + Intergenic
1035750555 8:1993232-1993254 ACCACAGAGGCCAGGCATGGTGG - Intronic
1036113674 8:5934195-5934217 ACCATAGAGCCTAGGTGTGCAGG + Intergenic
1037135008 8:15449972-15449994 ACCACATAGCCTAGGTGTGCAGG + Intronic
1037611504 8:20480076-20480098 ATCACCCAGCCCAGGCATGCGGG - Intergenic
1037649256 8:20821926-20821948 ACCACAGCTCCCATGACTGCAGG - Intergenic
1037755202 8:21705899-21705921 CCCACAGAGCCCAGGTGAGCAGG + Intronic
1040924023 8:52657548-52657570 TCCACAAAGCCCAGAAATGATGG - Exonic
1041654863 8:60338830-60338852 ATCACAGAAACCAGAAATGCGGG - Intergenic
1042112316 8:65393849-65393871 GCCAGAGAACCCAGGAAAGCTGG + Intergenic
1042608903 8:70576798-70576820 GCCACTGTGCCCAGGAGTGCGGG - Intronic
1043027698 8:75091474-75091496 ACCACAGGGCCCTGGATGGCTGG - Intergenic
1044352523 8:91183838-91183860 ACCACAGAGGCAAGGAAGCCTGG + Intronic
1045502952 8:102757259-102757281 CCCACAGAGCCCAGCAGGGCAGG - Intergenic
1045650960 8:104341370-104341392 AAGACAGTGCTCAGGAATGCCGG + Intronic
1046440022 8:114243625-114243647 GCCACTGGGCCAAGGAATGCTGG + Intergenic
1046507258 8:115152003-115152025 AACACAGAAACCAGGAATGCTGG - Intergenic
1047333414 8:123913560-123913582 AACACAGAGCCCAGCAAGGGAGG - Intronic
1047996859 8:130345171-130345193 ATAACAGAGCGCAGAAATGCTGG + Intronic
1048504243 8:135006394-135006416 ACCACAGAGCCCATTAGAGCTGG - Intergenic
1048843450 8:138584750-138584772 ACCACAGAAGCCAGGGCTGCCGG + Intergenic
1049154536 8:141058823-141058845 CACACAGATCCCAGGCATGCTGG - Intergenic
1051093183 9:13434201-13434223 ACCACATAGACAAGGAAAGCTGG - Intergenic
1051686539 9:19663995-19664017 ACCACAGTGCTCAGGATGGCAGG - Intronic
1054460357 9:65459060-65459082 AGCAGAGAGGCCAGGAAGGCTGG + Intergenic
1055917131 9:81415956-81415978 ACCAGAGAGACCAGGAGTGCAGG + Intergenic
1056323895 9:85460935-85460957 GCCACTGGGCCAAGGAATGCCGG + Intergenic
1057427446 9:94964239-94964261 ACCTCAGAGCTCAGGCCTGCAGG - Intronic
1058664949 9:107304801-107304823 ACCACTGAGCTTAGGAGTGCTGG + Intronic
1060184743 9:121557560-121557582 AACACAGAGCTCAGGAAGCCTGG + Intergenic
1061191740 9:129086278-129086300 CCCACAGTGCCCAGGAAGGCAGG - Intronic
1061205829 9:129162704-129162726 ATCACAGTGCACAGGAAAGCAGG - Intergenic
1061225416 9:129278424-129278446 ATCACAGGCCCCAGGAAGGCAGG + Intergenic
1061665840 9:132160911-132160933 ATCAGAGAGCCCAGGGCTGCCGG + Intergenic
1061877131 9:133549865-133549887 ACCACAGACCCCAGAGCTGCAGG + Intronic
1062031598 9:134364465-134364487 AACACAGAGCCCATGACAGCCGG - Intronic
1062362561 9:136194555-136194577 CCCACAGACCCCAGGTCTGCAGG - Intergenic
1062378784 9:136276852-136276874 GGCACAGAGGCCAGGAGTGCAGG + Intergenic
1062645821 9:137547614-137547636 ACCACAGTCCCCAAGAGTGCAGG + Exonic
1062702854 9:137917158-137917180 TCTCCAGAGCCCAGGAATCCTGG + Intronic
1185665665 X:1763398-1763420 AGCCACGAGCCCAGGAATGCTGG + Intergenic
1185701300 X:2232446-2232468 ACCCCAGACCCCAGGACTGCAGG - Intronic
1185791173 X:2929023-2929045 ACAGCAGAGCCCAGGGATGGGGG - Intronic
1186161197 X:6778758-6778780 CCCACAGAGCCGACAAATGCAGG + Intergenic
1186879036 X:13846250-13846272 ACAACTGAGCCTAGAAATGCTGG - Intronic
1187689540 X:21851172-21851194 AGCAAAGTGCCAAGGAATGCAGG - Intronic
1188028652 X:25238906-25238928 ACAGCAGAGTCCAGGAATTCTGG + Intergenic
1197700365 X:129595097-129595119 ACCAGGAAGCCCAGGAATGAGGG - Intergenic
1198794975 X:140385057-140385079 ATCACTGAGCCAAGGAAGGCTGG - Intergenic
1199671536 X:150152127-150152149 AAGAGAGAGGCCAGGAATGCTGG - Intergenic
1202015324 Y:20400388-20400410 ACAACAGAGACCAGGCATGGTGG + Intergenic