ID: 1123998108

View in Genome Browser
Species Human (GRCh38)
Location 15:25733156-25733178
Sequence GTGGTGTGAAGGAGGTTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123998102_1123998108 -5 Left 1123998102 15:25733138-25733160 CCGGCATTCCTGGGCTCTGTGGT 0: 1
1: 0
2: 1
3: 32
4: 396
Right 1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG 0: 1
1: 0
2: 0
3: 10
4: 88
1123998097_1123998108 14 Left 1123998097 15:25733119-25733141 CCTAAAAGAAGCAAATCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123998108 Original CRISPR GTGGTGTGAAGGAGGTTACG GGG Intronic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG + Intronic
909864963 1:80656174-80656196 GTGGTTTGAAGAAGCTTACCAGG + Intergenic
912473382 1:109921071-109921093 GTGGTGTGGAGAAGGGAACGGGG - Intronic
912866816 1:113264952-113264974 CTGGTGTGAAGGACCTTATGTGG - Intergenic
914855475 1:151347210-151347232 CTGGAGTGAAGGTGGCTACGAGG - Exonic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1065141835 10:22725773-22725795 ATGGTGTGATGGAGGTTACCTGG - Intergenic
1065758519 10:28958852-28958874 GTAGGGAGAAGGAGGTTAAGGGG + Intergenic
1083592669 11:63904606-63904628 GTGGTGAGAAGGAAGTCTCGTGG - Intronic
1084266190 11:68006550-68006572 GTGGTGTGAAGGGAATCACGTGG - Intergenic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1092776475 12:11948707-11948729 GTGGTGGGAACGAGATGACGGGG - Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG + Intergenic
1106506655 13:30376350-30376372 GTGGAGGGAAGGGGGTTAGGGGG + Intergenic
1107017405 13:35718789-35718811 GTAGCCTGAAGGATGTTACGTGG + Intergenic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1116193649 14:41692557-41692579 GTGGTGTGGGGGAAGTTAGGAGG - Intronic
1121444637 14:93970785-93970807 GTGATGTGAAGCAGGTTACTCGG + Intronic
1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG + Intergenic
1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1136297865 16:29313906-29313928 GTGGAGTAAAGCAGGTCACGAGG + Intergenic
1146630151 17:34463808-34463830 GTGCTGTGACGGAGGTGGCGGGG - Intergenic
1156265124 18:35480988-35481010 GTGGTGTCATGGAGATTATGAGG - Intronic
1162366807 19:10254663-10254685 GTGGTGGGAAGGAGCTTCCTGGG + Intronic
1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG + Exonic
1163262997 19:16202483-16202505 GGGGTGTGAAGAAGCTTTCGGGG - Intronic
924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
933741185 2:85535496-85535518 GTGTTGAGAAGGAGGTTCCTAGG - Intergenic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942218577 2:173746898-173746920 GTGGTGTGAAGCAGGCTCCAGGG + Intergenic
1170487103 20:16829503-16829525 GTGGTGATTAGGAGGTTAAGAGG - Intergenic
1171116540 20:22529710-22529732 GTTGTGTGAAGCAGTTTAGGTGG - Intergenic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG + Intronic
1178936854 21:36870257-36870279 GTGGTGTCAATGAGGTTCCCGGG - Intronic
1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG + Exonic
949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG + Intergenic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
954160537 3:48718454-48718476 GTGGGGTGAAGTAGGTTTGGCGG - Intronic
954875411 3:53800002-53800024 GTTTTGCAAAGGAGGTTACGGGG + Intronic
955044922 3:55350709-55350731 GTGGAGTGGAGGATGTTAGGAGG - Intergenic
961420354 3:126798123-126798145 GTGGTGTGCTGGAGGTTCTGCGG + Intronic
961716477 3:128861106-128861128 GTGGGGTGCAGGAGGTGAAGGGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
968949757 4:3684364-3684386 GTGGTGGGATGGAGGGTAGGGGG - Intergenic
968975974 4:3822235-3822257 GGGGCGTGTAGGAGGTTGCGGGG - Intergenic
969411597 4:7031992-7032014 GTGCTGGGAAGGAGGGCACGGGG - Exonic
975281050 4:72563373-72563395 GTGTGGTGAAGGAGGTTTAGGGG - Intronic
977479020 4:97550437-97550459 GTGGAGTGAAAAAGGATACGGGG + Intronic
984743926 4:183195377-183195399 GTGTTGAGAAGGAGGCTAAGAGG - Intronic
994084905 5:95747372-95747394 GTGGTGTGGAGAAGGTTAATTGG - Intronic
994825281 5:104705901-104705923 GTGGTGTGAAAGATGTCACTTGG - Intergenic
996339051 5:122415972-122415994 GTGGGGTGCAGAAAGTTACGTGG - Intronic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1009969525 6:70612304-70612326 GTGGTGTGGAGGTGGGTAGGGGG - Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1018067218 6:160132459-160132481 GTGGGGTCAAGGAGCTTGCGGGG + Intronic
1018533483 6:164793779-164793801 GTGGTCTGAAGAAGTTTATGGGG + Intergenic
1018845013 6:167549686-167549708 GGGATGTGAAGAAGGTTAGGAGG - Intergenic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020078738 7:5275274-5275296 CTGCTGTGAACGAGGTTACAGGG - Intronic
1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG + Intergenic
1024342476 7:48281603-48281625 GTGGTGGGAATGAGGTTGGGAGG - Intronic
1025200158 7:56956911-56956933 CTGCTGTGAAGGAGGTTATGGGG + Intergenic
1025671787 7:63620021-63620043 CTGCTGTGAAGGAGGTTATGGGG - Intergenic
1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG + Intronic
1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG + Intronic
1035600768 8:895681-895703 GTGGTGTGAAGGAGGGTTATGGG + Intergenic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1042974334 8:74449027-74449049 ATGGTGTGAAGGAGGCTCCAAGG + Intronic
1043944024 8:86229804-86229826 GTGGTGTGAAAGAAGTGACTTGG - Exonic
1045978846 8:108160612-108160634 GTTGTGTGAAGGAGGTTTAGTGG - Intergenic
1047192231 8:122688637-122688659 GCGGGGTGAAGGATGTTATGGGG - Intergenic
1050339329 9:4620198-4620220 GTTATGAGAAGGAGGTTATGAGG - Intronic
1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG + Intergenic
1059310712 9:113387338-113387360 GTGCTCTGAAGGAGGTCACCAGG - Exonic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1189608450 X:42704988-42705010 CTGCTGTCAAGGAGGTTACAGGG + Intergenic
1189855800 X:45223872-45223894 GTGGTGTCAGAGAGGTTACTGGG - Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1196057102 X:111367675-111367697 GTGCTGTGTAGTAGGGTACGTGG + Intronic