ID: 1123999194

View in Genome Browser
Species Human (GRCh38)
Location 15:25740697-25740719
Sequence CACCTCTGTCTACCTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123999192_1123999194 5 Left 1123999192 15:25740669-25740691 CCTCGAAGGCTCTCAGTGACAAA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 264
1123999191_1123999194 17 Left 1123999191 15:25740657-25740679 CCTGGACATGGTCCTCGAAGGCT 0: 1
1: 0
2: 0
3: 11
4: 89
Right 1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 264
1123999188_1123999194 30 Left 1123999188 15:25740644-25740666 CCTTGACATCACGCCTGGACATG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123999194 Original CRISPR CACCTCTGTCTACCTGGCTT TGG Intronic
900093821 1:932306-932328 CTCCTCCGTCTGCCTGGCCTCGG + Intronic
900159194 1:1215498-1215520 CTCCTCTGCCCACCTGGGTTGGG - Intergenic
900649191 1:3722728-3722750 CACCTCTCTTCACCTGGCATGGG + Intronic
900649218 1:3722834-3722856 CACCTCTCTGCACCTGGCATGGG + Intronic
900649238 1:3722918-3722940 CACCTCTCTGCACCTGGCATGGG + Intronic
900710050 1:4107909-4107931 CACTTCTGTGTACCTGCCCTCGG + Intergenic
901761240 1:11473103-11473125 CTCCTCTGTCTCTCTGGCTTTGG - Intergenic
903538733 1:24084571-24084593 GACCTCTGTCTCCCTGACATGGG - Exonic
904558383 1:31380470-31380492 CAACACTGTCAGCCTGGCTTGGG + Intergenic
904689197 1:32281155-32281177 AACCTCTGCCTCCCTGGCTCAGG - Intronic
904849693 1:33447969-33447991 CACCTTTTTCCACCTTGCTTTGG - Intergenic
906339203 1:44963349-44963371 AACCTCTGTCTCCCAGGCTCAGG + Intronic
907182797 1:52585681-52585703 CACCACTCCCTACCTGGGTTAGG + Intergenic
907222446 1:52916872-52916894 CACTTCTGTCCAGATGGCTTGGG + Intronic
911594672 1:99786711-99786733 CACCTCGGTCTTCCTGACTCAGG + Intergenic
912972038 1:114292693-114292715 CAACTCTGTCTTCCTGTCCTTGG - Intergenic
915485805 1:156219829-156219851 AACCTCCGCCTCCCTGGCTTAGG + Intronic
916478875 1:165197194-165197216 CACTTCTGTCTTCCTGGATGGGG - Intergenic
917636113 1:176938581-176938603 CCTCTCTGGCTACCTGGCTCAGG + Intronic
918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG + Intergenic
918263472 1:182818249-182818271 CACCCCTGTCTACAAGGTTTTGG + Intronic
920181524 1:204134837-204134859 CACTGCTGACTACCTGCCTTAGG - Intronic
920439201 1:205967398-205967420 TACCTCTGTCTCCCTTTCTTGGG + Intergenic
1063000100 10:1909229-1909251 CACCTCTGTCTATCCTGCATGGG + Intergenic
1063980222 10:11446509-11446531 CACCACGGTCTAACTGACTTGGG + Intergenic
1064022024 10:11816728-11816750 AACCTCTGTCCCCTTGGCTTAGG - Intergenic
1064168634 10:13008347-13008369 GGCCTCTGACTCCCTGGCTTGGG - Intronic
1064189615 10:13194279-13194301 CACCTCTGCCTCCCAGGCTCAGG - Intronic
1065931457 10:30482810-30482832 CACCTCTGCTTCCCTGGCTCAGG + Intergenic
1067363949 10:45607914-45607936 GACTTCTGTCTCCCTGGCTTTGG - Intergenic
1067509481 10:46883300-46883322 CTACTCTCTCTACCTGGCTCTGG + Intergenic
1067652773 10:48168555-48168577 CTACTCTCTCTACCTGGCTCTGG - Intronic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1069925386 10:71846926-71846948 CACACCTGTCTAAGTGGCTTTGG + Intronic
1069986380 10:72286983-72287005 CACCTCTGTCACCCAGGCTGGGG - Intergenic
1070825736 10:79389384-79389406 AAGCTCTGTCTATCTGACTTTGG - Intronic
1070895979 10:79983148-79983170 CATCTCTGGCTCCCTGGCTTGGG + Intergenic
1070979579 10:80633468-80633490 GACCTCTGCCAACCTGGCTATGG - Intronic
1071051691 10:81458456-81458478 CACCTCTGTCTACAGAGCTAAGG + Intergenic
1071278453 10:84077527-84077549 CACCTCTGCCTCCCAGGCTCAGG - Intergenic
1073179718 10:101576405-101576427 CACCTCTGCCTCCCAGGCTCAGG + Intronic
1073487615 10:103830003-103830025 CACCTGAGTCTACCTGGGGTGGG - Intronic
1075286947 10:121195245-121195267 AGCCTCTGTCTACCTGCCTGGGG - Intergenic
1075340761 10:121645343-121645365 CACCTGTGGCTACCTGGCCATGG - Intergenic
1075866444 10:125725095-125725117 CACCTCTCCCAGCCTGGCTTAGG + Intronic
1076245224 10:128942055-128942077 AACCTCTGTCTCCCAGGCTCAGG - Intergenic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077092610 11:786573-786595 GAGCTCTGTCTTCCTGGCTCTGG - Intergenic
1077136264 11:1000665-1000687 CACCTCTGTCCAGCTGGCCGCGG - Intronic
1077892767 11:6431412-6431434 AAGCTCTGTCCACGTGGCTTGGG + Exonic
1079480114 11:20871275-20871297 CACCCCTCTTTGCCTGGCTTTGG - Intronic
1081962746 11:47150438-47150460 CACCTCTGTCTCCCTGCTTGTGG - Intronic
1084109459 11:67004268-67004290 GACCTCTGGTTACCTTGCTTTGG - Intergenic
1084120010 11:67063409-67063431 AACCTCTGTCTCCCAGGCTCAGG - Intronic
1084474201 11:69379459-69379481 ACCCTCTGTCTCCCAGGCTTAGG - Intergenic
1084855724 11:71984658-71984680 AACCTCTGCCTCCCAGGCTTAGG + Intronic
1085514354 11:77103724-77103746 CATCTCTGTCTCCCTGACTCTGG - Intronic
1086512908 11:87579353-87579375 CACCTATGTTTACCTGTGTTTGG - Intergenic
1086968584 11:93055923-93055945 CAGCTTTGGCTACCTGGCTATGG + Intergenic
1088881002 11:113973211-113973233 AACCTCAATCTCCCTGGCTTAGG - Intergenic
1091871927 12:3899258-3899280 CACGTCTGTGTACTTGGCCTTGG + Intergenic
1092694242 12:11151139-11151161 CACCTCTCTTTTCCTGTCTTGGG + Intronic
1093448245 12:19284899-19284921 CTGCTCTGTCTCCCAGGCTTGGG - Intronic
1094111683 12:26869366-26869388 AACCTCTGTCTCCCAGGCTCAGG + Intergenic
1096607933 12:52780120-52780142 CACCTCTGCCACCCTGGCCTAGG + Intergenic
1097728771 12:63104493-63104515 CCCCTCTGACTACCAGGCCTTGG + Intergenic
1099105318 12:78488687-78488709 CAACTTTATCTACCTGGCTGGGG + Intergenic
1099373072 12:81862115-81862137 AACCTCTGCCTCCCTGGCTCAGG + Intergenic
1099397371 12:82157620-82157642 CACCTCTGCATCCCTGGCTCGGG - Intergenic
1100706991 12:97211635-97211657 CACCTCTGTCTCACTGGCCCTGG + Intergenic
1101869284 12:108549929-108549951 AACCTCTGTCTCCCAGGCTCAGG - Intronic
1102303414 12:111787540-111787562 CACCTCTGTTTACATGTCATAGG - Intronic
1103486825 12:121288682-121288704 CCCCTCTGCCCACGTGGCTTAGG - Intronic
1103707002 12:122880826-122880848 CACCTCTGTGTGCCAGGCTCGGG + Intronic
1104197167 12:126551685-126551707 AACCTCTGTCTCCTGGGCTTAGG - Intergenic
1104593145 12:130100474-130100496 CTCCACAGACTACCTGGCTTAGG - Intergenic
1105284865 13:18995517-18995539 CACCTCTGTCCATCTGGCTTGGG - Intergenic
1105496079 13:20932060-20932082 CACCACTGTCTGCGTGGATTGGG + Intergenic
1106520327 13:30491579-30491601 AACCTCTGCCTCCCAGGCTTAGG - Intronic
1106658833 13:31777078-31777100 CACCTCTGGGTACCTGGGTCTGG - Intronic
1108439486 13:50436269-50436291 AACCTCTGTCTTCCAGGCTCAGG + Intronic
1110109930 13:71733241-71733263 AACCTCTGTCTCCCAGGCTCAGG + Intronic
1110920661 13:81080062-81080084 TATCTCTGGCTACCAGGCTTAGG + Intergenic
1111877808 13:93918677-93918699 CAGCTCTGTCAACAGGGCTTAGG + Intronic
1113563209 13:111300558-111300580 CACCTCTGTCTACCGAGCCCAGG - Intronic
1113718003 13:112527893-112527915 CACCTCTGTGTTCCAGGCTTTGG - Intronic
1117133593 14:52710345-52710367 AACCTCTGCCTCCCTGGTTTAGG - Intronic
1117744992 14:58860457-58860479 CACCCCTGGCTACCTGCCTGTGG - Intergenic
1117991922 14:61442321-61442343 CACCTCTGTTAACCTGGAATAGG - Intronic
1118306647 14:64660574-64660596 CTCCTCTGTGGACCGGGCTTTGG + Intergenic
1118497413 14:66322123-66322145 AACCTCTGTCTCCCAGGCTCAGG - Intergenic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1119831993 14:77711635-77711657 AACCTCTGCCTCCCAGGCTTAGG + Intronic
1121356928 14:93223493-93223515 CATCTCTGTCTACCTACTTTAGG + Intronic
1121849733 14:97209919-97209941 CAGCTCTGTCTCCATGGCCTGGG - Intergenic
1122626265 14:103086883-103086905 CACCTCTGTCCACCCTGCCTGGG - Intergenic
1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG + Intronic
1124881846 15:33650020-33650042 CACCTCTGGCTACTAGTCTTTGG - Intronic
1126114376 15:45195761-45195783 CACTCCTGTTTGCCTGGCTTTGG + Intronic
1128684127 15:69671204-69671226 CACCCCTGGCTCCCTGACTTGGG - Intergenic
1128770796 15:70280923-70280945 CTCCTCTGTGTGCCTGGCTAAGG + Intergenic
1129707084 15:77800422-77800444 TCCCTCTGTCCAGCTGGCTTTGG - Intronic
1129786322 15:78312607-78312629 CACCTCTATCTTCCTGCCCTGGG + Intergenic
1130124781 15:81084311-81084333 CTCCTCACTCCACCTGGCTTAGG + Intronic
1130726860 15:86448061-86448083 AACCTCTGCCTCCCTGGCTCAGG - Intronic
1133497617 16:6334599-6334621 CACATCTGTGTATCTGGATTGGG + Intronic
1135386350 16:22044276-22044298 CACTTCTGGCTACCTAACTTGGG - Intronic
1135755438 16:25093208-25093230 CACCAATGTCTTCCTGGTTTGGG + Intergenic
1136664759 16:31800332-31800354 CACCTCTGTGTGCATGTCTTAGG - Intergenic
1138136723 16:54529807-54529829 TACCACTTGCTACCTGGCTTAGG - Intergenic
1138483006 16:57316614-57316636 CAGCTCTATCTCCTTGGCTTGGG + Intergenic
1139126087 16:64079379-64079401 AACCTCTGTCTCCCAGGCTCAGG - Intergenic
1139587190 16:67911598-67911620 AACCTCTGTCTACTGGGTTTAGG - Intronic
1139590384 16:67929848-67929870 CATGTCTGTCTTCCTGGCTCAGG - Exonic
1140411207 16:74741540-74741562 CACCTCTGTCTTCTGGGCCTAGG + Intronic
1141623212 16:85248054-85248076 CAGCTCTGTCCACCTGCCTGTGG + Intergenic
1142536778 17:623101-623123 CAGGCCTGTATACCTGGCTTTGG + Intronic
1142578482 17:925345-925367 CTCCTCTGTGTTCCTGGGTTTGG - Intronic
1143907166 17:10218178-10218200 CAGCTCTGTCTTACTGGCTCTGG - Intergenic
1145744723 17:27307833-27307855 CATCTCTGGCTACCGGGCTGGGG + Intronic
1147979199 17:44264374-44264396 AACCTCTGCCTCCCAGGCTTAGG - Intronic
1148333107 17:46823830-46823852 CATCTCTGAGTCCCTGGCTTCGG + Intronic
1148852567 17:50561925-50561947 CACCTCAGTCTTCCTGGGTTGGG + Intronic
1148977439 17:51541848-51541870 CCCCTTTGTCTCCCTGGCTCAGG - Intergenic
1150795897 17:68236651-68236673 AACCTCTGTCTCCCAGGCTCAGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152173479 17:78770066-78770088 AACCTCTGACTCCCTGGCTTAGG - Intronic
1152320007 17:79603446-79603468 TACTTCTTTCTGCCTGGCTTCGG + Intergenic
1152400452 17:80063445-80063467 CACCTCAGTCAACCAGGCTGTGG + Intronic
1153586065 18:6621901-6621923 CTCCTCTGTCTTCCTGTCTTTGG + Intergenic
1156056449 18:33010539-33010561 CATCTCAGTCTAGCTGCCTTAGG + Intronic
1159059564 18:63500615-63500637 CACCTCTGCTTAGCTGGCTGAGG + Intronic
1160053780 18:75460955-75460977 CATCTCTGTCTACCAGTCGTAGG + Intergenic
1160237790 18:77099625-77099647 CACCATTGGCTACCTGGCCTCGG + Intronic
1160704566 19:524031-524053 CACCTCAGCCTGCCTGGCTGTGG - Intergenic
1161228168 19:3157604-3157626 CACCCCTATCTGCCTGGCTGGGG - Intronic
1161423317 19:4187699-4187721 CACCTCTTTGTGCCTGGCCTGGG + Intronic
1162130796 19:8525166-8525188 CAACTCTGTCTCCCAGGCTGGGG - Intronic
1165316825 19:35060853-35060875 CTCCTCTGTCCTCCTGGCCTCGG - Intronic
1165472350 19:36010756-36010778 CACCTCCCTGTCCCTGGCTTGGG - Intronic
1167606803 19:50485599-50485621 CACCTCTGTCTCCATGGCCTTGG + Exonic
1168054650 19:53855783-53855805 CACAGCTGTCTCCCTGGCTAGGG - Intergenic
925346222 2:3173840-3173862 CTCCTCTTTCAAGCTGGCTTGGG - Intergenic
925788081 2:7452500-7452522 CTCCTCTGTATCCCTAGCTTTGG - Intergenic
926854939 2:17245127-17245149 AACCTCTGTCTCCCAGGTTTAGG - Intergenic
927779318 2:25926717-25926739 CCCCTCTGTCCCCTTGGCTTCGG - Exonic
927919182 2:26958439-26958461 AACCTCCGTCTCCCAGGCTTAGG - Intergenic
929110282 2:38400520-38400542 AACCTCTGCCTCCCAGGCTTAGG - Intergenic
929186184 2:39097637-39097659 AACCTCTGCCTCCCAGGCTTGGG + Intronic
929500117 2:42483037-42483059 AACCTCTGCCTCCCTGGCTCTGG - Intronic
930652769 2:53978839-53978861 AACCTCTGCCTCCCAGGCTTAGG - Intronic
932740515 2:74287370-74287392 CACCCTTGTCTAGCTGGATTGGG - Intronic
935207928 2:100912745-100912767 CTCCTCTTAGTACCTGGCTTTGG + Intronic
938147310 2:128847498-128847520 CACCCCTATCTACCAGGATTTGG - Intergenic
940803539 2:158158611-158158633 AACTTCTGTCTACATGGATTGGG - Intergenic
943846311 2:192653943-192653965 AACCTCTGCCTACCAGGCTCAGG + Intergenic
946647264 2:221851123-221851145 AACGTCTCTCTACCTGGCTTGGG + Intergenic
947413718 2:229871090-229871112 AACCTCTGTCTCTCAGGCTTAGG - Intronic
948332164 2:237178233-237178255 CTCCTCTGCCTTCCTGCCTTGGG + Intergenic
1170144559 20:13158718-13158740 CCTCTCTGGCTCCCTGGCTTGGG - Intronic
1171969193 20:31552878-31552900 CACCTCTGTGTACCTGTTGTTGG + Intronic
1172271623 20:33658598-33658620 CACCTCTGCCTCCCCGGCCTGGG + Intronic
1172355545 20:34277184-34277206 CACCTCTGTGTGACTGGCTGTGG - Intergenic
1173802280 20:45901815-45901837 CACCTCTGCCTCCCGGGTTTAGG - Intronic
1173971510 20:47156250-47156272 AACCTCTGTCTCCCGGGCTCAGG - Intronic
1174400225 20:50271995-50272017 CACCTCTGCCTTCCTGGTCTGGG + Intergenic
1175997733 20:62818947-62818969 CACCTCGGCCTCCCTGGCTAAGG - Intronic
1178911708 21:36679640-36679662 AACCTCTGTCTCCCAGGCTCAGG - Intergenic
1179770556 21:43612294-43612316 CACCTGTGTCATCCTGGCCTCGG - Intronic
1181003558 22:19999093-19999115 CTCCTCTGCCTCCCTGGCTGTGG - Intronic
1182304118 22:29356238-29356260 CTCTCCTGTCTACCTGGCTCTGG + Intronic
1182325772 22:29511521-29511543 CACCTCTGTTTTCCTGGCTGTGG - Intronic
1182336059 22:29584250-29584272 CACCTCCGCCAACCTGACTTTGG + Intergenic
1184073828 22:42163610-42163632 CACCTCTGGCCACGTCGCTTTGG - Intronic
1184275148 22:43405683-43405705 CACCACTGTTGACCTGGCTCTGG + Intergenic
949367922 3:3302956-3302978 CACCTCTCTGTATCTGGATTCGG - Intergenic
949498915 3:4659601-4659623 AACCTCTGCCTCCCAGGCTTAGG - Intronic
950108691 3:10404757-10404779 CACCTGTGTCTCCCAGTCTTTGG - Intronic
950895881 3:16450380-16450402 CACCTCTGTGCACCTGGATGTGG - Intronic
952766778 3:36961224-36961246 AACCTCTGCCTCCCAGGCTTAGG + Intergenic
952955144 3:38552211-38552233 CTCCTGTGACTACCTGGGTTTGG + Intronic
954686131 3:52371281-52371303 CACCTCTGTCCTCCTGGGCTGGG - Intronic
956797295 3:72728452-72728474 CACTTCTGTCTTCTTGGCTTTGG + Intergenic
959489174 3:106967096-106967118 AACCTCTGCCTCCCAGGCTTAGG + Intergenic
962775100 3:138651729-138651751 AACCTCTGTCTCCTGGGCTTAGG - Intergenic
963728842 3:148951079-148951101 AACTTCTGTCCTCCTGGCTTAGG - Intergenic
963729034 3:148953257-148953279 CACCTCTGTTTGGCTGCCTTTGG + Intergenic
963965792 3:151368841-151368863 AACCTCTGCCTCCCGGGCTTAGG + Intronic
965589301 3:170347576-170347598 AACCTCTGTCTCCCAGGCTCAGG + Intergenic
965723154 3:171684146-171684168 CACCTCTGTCAACCTGGGGTAGG + Intronic
967378684 3:188833404-188833426 CAACTCTGTCTCACTGGCATAGG - Intronic
968234082 3:197021529-197021551 CACCTCTGGAGGCCTGGCTTGGG + Intronic
968651672 4:1762603-1762625 CCCTCCTGTCTCCCTGGCTTGGG - Intergenic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969918016 4:10509466-10509488 CACCTCTGCCTACCCAGCTCAGG + Intronic
971252497 4:24985223-24985245 CACCTCTGTCCTCCTGTCTTGGG + Intergenic
973131483 4:46653717-46653739 CATCTCTGTCCCCATGGCTTTGG + Intergenic
975366047 4:73529025-73529047 GACCTCAGGCTACCAGGCTTTGG - Intergenic
975825872 4:78319056-78319078 AACATCGGTCTTCCTGGCTTTGG - Intronic
980100727 4:128539105-128539127 CACCTCTCTCTGCCTCGCTAGGG + Intergenic
980484743 4:133441095-133441117 AACCTCTGCCTACCTGGTTCAGG + Intergenic
980912446 4:139005940-139005962 CACCTCTGCCTCCCTGGCTCAGG - Intergenic
981081365 4:140642326-140642348 CACCCCTATCTTCCTGGCTTTGG + Intronic
982001633 4:151026089-151026111 GACCACTGTAAACCTGGCTTTGG + Intergenic
983090422 4:163495159-163495181 CACCTCTGCCTCTCTGGCCTGGG + Intronic
986324816 5:6664484-6664506 CACCTCTGCCTCCCAGGCTCAGG + Intronic
986785584 5:11111377-11111399 CACCTCTGACTCCCTGGCTGGGG + Intronic
989414642 5:41159514-41159536 AACCTCTGTATTCTTGGCTTTGG + Intronic
990528591 5:56652350-56652372 CAGCTCTCTCTACCTACCTTGGG + Intergenic
991637767 5:68723301-68723323 AACCTCTGTCTCCCAAGCTTAGG - Intergenic
992946988 5:81820823-81820845 CACCTCTGCCCACCTGGTCTTGG + Intergenic
993035260 5:82749004-82749026 CACCTCTTTCTACATGCCTGTGG - Intergenic
994002226 5:94793669-94793691 CTCCTCTGTCAGCTTGGCTTTGG + Intronic
994405053 5:99334925-99334947 CACCTCTGCTTACCTGGCCTTGG + Intergenic
995256548 5:110053363-110053385 CATCTCTCTCTACATGGCTAGGG - Intergenic
995448995 5:112279825-112279847 CACCTCTTACTTACTGGCTTAGG + Intronic
998376896 5:141697013-141697035 CACCTCTATCTACATAGCATAGG - Intergenic
999321810 5:150619846-150619868 CACCATTGTCTACCAGGCTGGGG + Intronic
999594230 5:153184479-153184501 CATATCTCTCTACCTGGCTCTGG - Intergenic
1000175207 5:158745469-158745491 GTCTTCTGTGTACCTGGCTTAGG - Intronic
1001750903 5:174130594-174130616 CACCTCTGTGTACCTCCCTTGGG + Intronic
1002439621 5:179257524-179257546 CAGCTCTGTCTGCCTGGGCTGGG + Intronic
1004436451 6:15599575-15599597 CATCTGGGTCTACCTAGCTTGGG + Intronic
1004643404 6:17537266-17537288 AACCTCTGCCTCCCAGGCTTAGG + Intronic
1005273997 6:24197070-24197092 TACCTTTGGTTACCTGGCTTTGG + Intronic
1005617311 6:27586492-27586514 CACCACTGTCTGCCTGCTTTGGG - Intergenic
1005688938 6:28283138-28283160 GACCTCTGTATAGCTAGCTTGGG + Intronic
1008903121 6:56645766-56645788 AACCTCTGTTTACTTGGCCTTGG - Intronic
1010548838 6:77194163-77194185 TTCCTCTGTCTTCCTGCCTTGGG - Intergenic
1012000781 6:93652000-93652022 AACCTCTGCCTGCCTGGCTCAGG + Intergenic
1012563334 6:100615095-100615117 AACCTCTGTCTCCCAGGCTCAGG + Intronic
1014871715 6:126604025-126604047 CTCCTCTGTCTACTGGGCTCTGG + Intergenic
1015208186 6:130666028-130666050 CACCTCTGTCTTCCTGCCCCTGG + Intergenic
1015246055 6:131075868-131075890 AACCTCTGCCTCCCGGGCTTAGG - Intergenic
1017958991 6:159205503-159205525 CACCTCTGAACACCTGGCTCCGG + Intronic
1019344456 7:522564-522586 CGCCTCTGTCTCCCGGGCCTGGG - Intergenic
1019401362 7:855900-855922 CTCCTCTGTCTGCCTGCCCTGGG + Intronic
1020093897 7:5356989-5357011 CACCTCCATCTTCCTGGTTTTGG + Exonic
1020095943 7:5369420-5369442 CACCTCTTTCTTGCTAGCTTTGG - Intronic
1022360347 7:29650767-29650789 CATCTCTGGCTCCCAGGCTTGGG - Intergenic
1026329608 7:69340244-69340266 GTCCTCTGTCTACCTGGCCAGGG + Intergenic
1027730491 7:81865610-81865632 CTACTTTCTCTACCTGGCTTAGG - Intergenic
1027907410 7:84203611-84203633 AACCTCTGTCTCCCAGGTTTAGG + Intronic
1029605360 7:101595838-101595860 CCCCACTGTCTAGCTGGCTGTGG + Intergenic
1029663976 7:101982506-101982528 AACCTCTGCCTCCCAGGCTTAGG + Intronic
1030779731 7:113585256-113585278 CACCTCTGTCTCCCAGTGTTGGG - Intergenic
1031470385 7:122161499-122161521 CTACTCTGTCTATCTGGTTTGGG - Intergenic
1032525160 7:132574456-132574478 CACCTCTGTCTTCCGGGCTGTGG - Intronic
1033525360 7:142208155-142208177 AACCCATGTCTACCTGACTTGGG + Intronic
1037433092 8:18834688-18834710 CTCTTCATTCTACCTGGCTTTGG - Intronic
1038286048 8:26207252-26207274 CACCACTGTCCATCTGGCTATGG + Intergenic
1040629298 8:49191199-49191221 AACCTCTGCCTCCCAGGCTTAGG + Intergenic
1041139485 8:54801189-54801211 TGGGTCTGTCTACCTGGCTTTGG + Intergenic
1042242915 8:66682580-66682602 CAACTTTGTCTCCCTGGCGTGGG + Intronic
1042596336 8:70452054-70452076 AACCTCTGTCTCCCAGGCTCAGG + Intergenic
1044680984 8:94777146-94777168 AACCTCTGCCTCCCAGGCTTAGG + Intronic
1045015484 8:97997899-97997921 AACCTCTGTCTCCCAGGCTCAGG + Intronic
1045657857 8:104405701-104405723 CACCTCTGTCTGCCTGGAGCAGG + Intronic
1046548325 8:115680047-115680069 AACCTCTGTCTCCCGGGCTCAGG - Intronic
1047027780 8:120843255-120843277 CAGCTCTGTCTTCCTCACTTTGG + Intergenic
1047261263 8:123262593-123262615 CACCTCTGCCTCCCTGTGTTGGG + Intronic
1047424270 8:124730920-124730942 CAACTGTGTCTACGTGGCTATGG + Intergenic
1049247939 8:141572618-141572640 AACCTCTGGGTACCTGGCTGCGG + Intergenic
1050507977 9:6366910-6366932 AACCTCAGTCTACCTGCTTTAGG + Intergenic
1051084295 9:13330505-13330527 CACCTCTTACCACCTGACTTGGG + Intergenic
1056515988 9:87350607-87350629 AGCCTCAGTCTTCCTGGCTTAGG - Intergenic
1057547389 9:96028242-96028264 CCCCTCTGTTCACTTGGCTTTGG + Intergenic
1059339080 9:113587275-113587297 GACTTCTATCTTCCTGGCTTTGG + Intronic
1060912469 9:127361995-127362017 CACCTCTGTGTACCAGGCCCTGG + Intronic
1061589202 9:131588020-131588042 CACCTCTGTCTTCCAGGCCGGGG - Exonic
1061706682 9:132458325-132458347 CACCTTTGTCTCCCTGGCGGGGG + Intronic
1188786628 X:34354313-34354335 CTCCTCTTTCTACTAGGCTTAGG + Intergenic
1189717410 X:43881092-43881114 CACATCTGTCTAGCAGGCTCTGG - Intronic
1190742552 X:53299474-53299496 CTCATCTGTGTACCTGACTTTGG + Intronic
1192131357 X:68554350-68554372 CACCTGTATCTCCCTAGCTTTGG + Intergenic
1192898833 X:75472794-75472816 CACCACGGTCGACCTGGCTATGG + Intronic
1193660988 X:84258151-84258173 CACCCATGTCAACCTGGCATGGG - Intergenic
1195461918 X:105137113-105137135 CTACTCTCTCTACCTGCCTTAGG - Intronic
1196616064 X:117768872-117768894 CACCTCTCACAACCTGCCTTGGG - Intergenic
1197626228 X:128805080-128805102 CAACTCTGGCTTCCTGGCCTGGG + Intergenic
1200822928 Y:7606420-7606442 CACCTCTGACCACCTGCATTGGG - Intergenic
1201468915 Y:14313410-14313432 CACTTCTGTCTACCTAGCCAAGG + Intergenic
1201901646 Y:19049867-19049889 CACCTCTTTGTGCCTGGCGTGGG + Intergenic
1202012590 Y:20361152-20361174 TATCTCTGTCTCCCTGGATTTGG + Intergenic
1202237127 Y:22724675-22724697 CACCTCTGACCACCTGCATTGGG + Intergenic