ID: 1124002485

View in Genome Browser
Species Human (GRCh38)
Location 15:25770623-25770645
Sequence ATCTCAGGACCCCCAAACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124002483_1124002485 4 Left 1124002483 15:25770596-25770618 CCAGAGGGTTGCAAAGGAAAATA 0: 1
1: 0
2: 1
3: 17
4: 230
Right 1124002485 15:25770623-25770645 ATCTCAGGACCCCCAAACTTAGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124002485 Original CRISPR ATCTCAGGACCCCCAAACTT AGG Intronic
908203687 1:61823264-61823286 ATCTCAGGAGCCTCAAAGATGGG - Intronic
909185715 1:72482814-72482836 ATCTCACGTCACCCAATCTTAGG - Intergenic
909765466 1:79350234-79350256 TTCTCAGCACCCCCGACCTTAGG + Intergenic
913672478 1:121110711-121110733 ATCTCATTGGCCCCAAACTTTGG + Intergenic
914024243 1:143898075-143898097 ATCTCATTGGCCCCAAACTTTGG + Intergenic
914662736 1:149806102-149806124 ATCTCATTGGCCCCAAACTTTGG + Intronic
915612938 1:157009562-157009584 AGCTCAGTACCACCAACCTTAGG - Intronic
917154645 1:171983554-171983576 ATCTCCTGACCTCTAAACTTTGG + Intronic
918073104 1:181148217-181148239 CCCTGAGGACCTCCAAACTTGGG - Intergenic
918347694 1:183620085-183620107 ATCTGAGGACCCAGAAAATTTGG + Intergenic
921324086 1:213973480-213973502 ACCCCAGGCCCCCCAAACATGGG + Intergenic
923087999 1:230715972-230715994 ATTTCAGGACCCTCTAAATTTGG + Intergenic
1063577862 10:7278310-7278332 ATCACAGGATCCCCAAAAGTAGG + Intronic
1070750183 10:78959535-78959557 ATCCCTGGACCCTCAAAGTTGGG + Intergenic
1070895891 10:79982584-79982606 TTCTCAGCACCTCCAAACATGGG - Intronic
1071154531 10:82673660-82673682 ATCCCCCAACCCCCAAACTTTGG - Intronic
1073840445 10:107493318-107493340 ATCTCATGATCCCCCGACTTAGG - Intergenic
1073924897 10:108504395-108504417 ATCTTAGAACCACCAAAATTTGG - Intergenic
1075569431 10:123529159-123529181 TTCTTGGGAACCCCAAACTTGGG + Intergenic
1076400861 10:130184298-130184320 ATTTCAGAAGCCCCAGACTTGGG - Intronic
1080246593 11:30185970-30185992 ATCTCTGAAACCCCAAACATGGG - Intergenic
1081875969 11:46408594-46408616 ATCTCAGGGCACCCAGACTCTGG - Exonic
1083141023 11:60722099-60722121 GTCTCAGGACCCACACTCTTTGG - Intergenic
1091662718 12:2396575-2396597 AGCTGAGGATCCCAAAACTTAGG + Intronic
1097406172 12:59193453-59193475 ATCACAGGTCCACCAAATTTAGG - Intergenic
1099697850 12:86044212-86044234 TTCTCAGGACCCTCAAGGTTAGG + Intronic
1099738588 12:86601602-86601624 AACTCAGGACCCCCAGACTGCGG + Intronic
1104621387 12:130315627-130315649 ATCTTAGGAACCAAAAACTTTGG - Intergenic
1109650920 13:65325030-65325052 ATCTCAGAAACACCAAACTGAGG + Intergenic
1110191866 13:72739648-72739670 AGCTAAGGAACCCCAAGCTTAGG - Intronic
1112476356 13:99734512-99734534 ATTTCAGGGCTCCCTAACTTGGG - Intronic
1116309860 14:43311130-43311152 AGCTCAGTGTCCCCAAACTTAGG - Intergenic
1122625804 14:103084857-103084879 ATCCCAGGACCCCAGAACTCAGG - Intergenic
1124002485 15:25770623-25770645 ATCTCAGGACCCCCAAACTTAGG + Intronic
1127260297 15:57322480-57322502 AGATCACGACCCCCAAACTCAGG - Intergenic
1127614880 15:60674242-60674264 CTCTTAGCAACCCCAAACTTGGG - Intronic
1128147547 15:65340330-65340352 AGCTCAGGCCCCCCACCCTTTGG + Intronic
1129233064 15:74207427-74207449 ACCTCAGGACACTCAAACTCTGG + Intronic
1135986745 16:27189717-27189739 ATCTCAGCCCCTCCAGACTTTGG + Intergenic
1136652142 16:31682050-31682072 ATCTCAGGACCCCCAGAGGATGG + Intergenic
1136671767 16:31864827-31864849 ATCTCAGGACCCCCAGAGGATGG + Intergenic
1140932906 16:79644203-79644225 AGCACTGGACCCCCAAACTCTGG + Intergenic
1146022793 17:29293431-29293453 ATCTCAGGGCCCCCAAATTGAGG + Intronic
1151163959 17:72188564-72188586 CTCTCAGGAACACCAAAGTTAGG - Intergenic
1152334671 17:79693770-79693792 ATCTCAGGAACCCCAAATCAGGG + Intergenic
1154307032 18:13238156-13238178 ATCTCATGCCCTCCAGACTTGGG - Intronic
1157732113 18:50013066-50013088 ATCCCAGGATCCACAGACTTTGG - Intronic
1161003059 19:1920818-1920840 ATCTCAGGACCACCCAACACGGG - Intronic
1161994905 19:7706136-7706158 ATCACAGAACCCCCACACCTGGG + Intergenic
1162154085 19:8664797-8664819 ATCTCAGGCCCCCCAAGTCTGGG + Intergenic
1165177080 19:33938356-33938378 AACTCAGGAACCCCAAATTTGGG + Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1166218646 19:41352229-41352251 ACCTCAGGACCCCCAAGCTCTGG + Intronic
1167476965 19:49706725-49706747 ATCTGAGGACCACCAAACCCAGG + Intronic
926713834 2:15907862-15907884 ATCTCAGCCTCCCCAAACTCTGG - Intergenic
927743253 2:25590990-25591012 ACCTCAGCACCCCCGGACTTTGG - Intronic
928027174 2:27749783-27749805 ATCTCAGGACCCCCTCTCATTGG - Intergenic
928242623 2:29599958-29599980 ATCACATCACCCCCAATCTTAGG - Intronic
929058822 2:37902852-37902874 ATCTCAATCCCCCCAAAATTAGG + Intergenic
930778224 2:55196542-55196564 ATTCCAGGCCCCCCAAACTCCGG + Intronic
932607848 2:73176437-73176459 ATCTCAGGGCCCCCAGAGGTCGG + Intergenic
933740648 2:85531309-85531331 ATCTCAGGACACTGAAGCTTAGG + Intergenic
935949860 2:108318893-108318915 GCCTCAGGACCTCTAAACTTTGG - Intergenic
936760175 2:115768680-115768702 ATCTCAGGTCCTCAAAAGTTGGG - Intronic
939547131 2:143567656-143567678 AACAGAGGACCCCCAAACTCAGG + Intronic
940861670 2:158776639-158776661 AGCTAAGGAACCCCAAGCTTAGG + Intergenic
942982662 2:182100941-182100963 TTCTCATGACCACCAAACATGGG - Intronic
944173294 2:196802244-196802266 AGCTGAGGAACTCCAAACTTAGG - Intergenic
1170564506 20:17589452-17589474 ATCTCAGGCTCCCAAAATTTTGG + Intronic
1171279411 20:23883367-23883389 ATCTCAGGTCCCCCACAGTTGGG - Intergenic
1172295477 20:33807758-33807780 ATCCAAGGACCCCCAATCATTGG - Intergenic
1172327095 20:34044716-34044738 ATCTCAGGAGCTCCAAGCCTAGG - Intronic
1175128263 20:56768620-56768642 ATCTCAGGATTCAAAAACTTAGG + Intergenic
1176234261 20:64047029-64047051 ATCCCAAGACCCCCCAACTCTGG - Intronic
1176990431 21:15490242-15490264 AACTCAGGACACTAAAACTTAGG - Intergenic
1185018279 22:48358334-48358356 ATCTCTGGACCTCCAAGCTCAGG + Intergenic
949949247 3:9215755-9215777 AACTCAGGTCCCCCAGCCTTTGG + Intronic
950866489 3:16193762-16193784 ATCTCAAGGACCCCAAACTTCGG - Intronic
954584308 3:51720479-51720501 ATCCCAGGACTCCCAGCCTTGGG - Intergenic
954883634 3:53853259-53853281 ATCTCAGCAACCCCAAGGTTGGG + Intronic
957641782 3:82862451-82862473 ACCTCAGGCCTCCCAAACTGTGG - Intergenic
960389432 3:117058499-117058521 ATCTTAGGACCCACAAAATCTGG + Intronic
961457432 3:127031188-127031210 TACTCAGGACCCCCAAGCTCTGG + Intronic
961739220 3:129022359-129022381 ATCTGAGGAGCCGCAAACCTGGG - Intronic
963893912 3:150665245-150665267 ATCTCATGACCACCAAACAAAGG - Intronic
965720986 3:171661977-171661999 ATTTCAGGGTCCCCAAACTTAGG - Intronic
966464610 3:180215965-180215987 ATGTCAGTAGCCCCACACTTTGG - Intergenic
970629690 4:17926548-17926570 ATCTCAGAACCTCAAAAGTTAGG - Intronic
973697013 4:53500101-53500123 CTCTCAGGACCACCTAACTTTGG - Intronic
975859121 4:78657434-78657456 ATCTCAGGACATCTAAAATTGGG - Intergenic
981737001 4:147963590-147963612 ATCCCTTAACCCCCAAACTTTGG - Intronic
982996923 4:162360713-162360735 ATCTCTGGACACTGAAACTTGGG + Intergenic
983219075 4:165027111-165027133 GTCTCAAGACACCCAAACTGAGG + Intergenic
983338306 4:166423935-166423957 TTCTCAGAATCCCCAAACTCAGG + Intergenic
984337858 4:178415550-178415572 AACTCCGGACTCCCAAACTCAGG + Intergenic
984687047 4:182680656-182680678 ATCCCACGACCCCCACACTGTGG - Exonic
986452752 5:7882416-7882438 ATCTCAGTACCCCCACATTATGG + Intronic
988701022 5:33674589-33674611 AGCTTAGGACCCCCAAAATAAGG - Intronic
989035056 5:37162146-37162168 ATCCCAGGCCTCCCAACCTTGGG + Intronic
990137297 5:52661638-52661660 ATGTCAGAACCCCCAAAATATGG + Intergenic
996193311 5:120571966-120571988 GTCTCAGGACCTCCCAACATGGG + Intronic
997294713 5:132762257-132762279 ATCTTATGACACCCAAACCTGGG + Intronic
997943366 5:138178425-138178447 ATTTCTGGGCCCCCAAACGTTGG + Intronic
1010659268 6:78549943-78549965 ATCACAGGACCTACAAATTTAGG - Intergenic
1013579789 6:111522296-111522318 ATCTGAGGAGCCCCAAGCTTAGG + Intergenic
1013706285 6:112838559-112838581 ATCTCTTGACCCTCAAACCTTGG - Intergenic
1014744181 6:125180457-125180479 ATTTCAGGACCTTCAAAGTTAGG - Intronic
1017697890 6:157037171-157037193 ATTTCAGTAGCCCCAAACTGGGG - Intronic
1018225131 6:161621423-161621445 ACCCCAGGACCCCCAGCCTTGGG - Intronic
1020203947 7:6101284-6101306 TTCTGAGGACCTCCAGACTTAGG - Intergenic
1020495421 7:8845692-8845714 ATCTCAGGAACCCCAAAAGTGGG + Intergenic
1022686834 7:32604872-32604894 AAGTCAGGAACCCCAAACTGAGG - Intergenic
1023866137 7:44239301-44239323 GTCTCCGGACCCCCAGACCTCGG + Intronic
1029426349 7:100496337-100496359 ATCACCAGACCTCCAAACTTGGG - Intergenic
1038215962 8:25561966-25561988 AGCTCAGGACCCACCAACTGTGG - Intergenic
1038444878 8:27596390-27596412 ATCTAAGGACCCCCAACCCCAGG + Intergenic
1057330119 9:94106430-94106452 AGCTGAGGAGCCCCAAGCTTAGG - Intronic
1058843525 9:108933862-108933884 ACCTGAGGACCCCCAAACAGAGG + Exonic
1061692104 9:132341538-132341560 AGCTCAGGGCTCCCAACCTTTGG + Intronic
1185766456 X:2729617-2729639 ATCTGAAGACACACAAACTTGGG + Intronic
1188923875 X:36013960-36013982 AGCTCAGGACTCCCAAATTTAGG - Intergenic
1189246076 X:39564555-39564577 TTCTCAGGACCCCTAGACTCTGG - Intergenic
1192380816 X:70614237-70614259 ATCTCAGGATCCCCAATTCTAGG + Intronic
1194241326 X:91453036-91453058 ATTTCAGGACCTTGAAACTTGGG - Intergenic
1195168461 X:102243611-102243633 ATGTCATGACCCCCAACCTATGG + Intergenic
1195190396 X:102443476-102443498 ATGTCATGACCCCCAACCTATGG - Intronic
1199202110 X:145103826-145103848 TTATCAGGGCCCCGAAACTTAGG - Intergenic
1202061452 Y:20892745-20892767 ATCTCAGGTCCCCAAAAGGTGGG - Intergenic