ID: 1124003807

View in Genome Browser
Species Human (GRCh38)
Location 15:25780421-25780443
Sequence CACTCCCGGCACAGACCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 922
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 834}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124003803_1124003807 -5 Left 1124003803 15:25780403-25780425 CCTGGCATTAGCACCTCACACTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834
1124003798_1124003807 13 Left 1124003798 15:25780385-25780407 CCTGCCCCTGTCAGTTCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 259
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834
1124003802_1124003807 7 Left 1124003802 15:25780391-25780413 CCTGTCAGTTCACCTGGCATTAG 0: 1
1: 0
2: 0
3: 18
4: 134
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834
1124003800_1124003807 9 Left 1124003800 15:25780389-25780411 CCCCTGTCAGTTCACCTGGCATT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834
1124003797_1124003807 30 Left 1124003797 15:25780368-25780390 CCTGATCTCTGAGGGCTCCTGCC 0: 1
1: 0
2: 1
3: 18
4: 262
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834
1124003801_1124003807 8 Left 1124003801 15:25780390-25780412 CCCTGTCAGTTCACCTGGCATTA 0: 1
1: 0
2: 1
3: 26
4: 273
Right 1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG 0: 1
1: 0
2: 6
3: 81
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124003807 Original CRISPR CACTCCCGGCACAGACCTGG CGG Intronic
900730787 1:4258274-4258296 CCCTCCCATCACAGGCCTGGAGG + Intergenic
900738364 1:4314505-4314527 CCCTCCCATCACAGGCCTGGAGG - Intergenic
900767117 1:4513085-4513107 CACTCCCTGCCCTGTCCTGGGGG + Intergenic
900817301 1:4858436-4858458 CCCTCCCATCACAGACCTGGAGG + Intergenic
901885929 1:12222908-12222930 ACCTCCCATCACAGACCTGGAGG - Intergenic
902727481 1:18346836-18346858 CACTCCCGCCTCAGTCCTGTGGG - Intronic
902889354 1:19430683-19430705 CACTCCTAGCACACAGCTGGCGG + Intronic
903006711 1:20303504-20303526 CCTTCCCAGCTCAGACCTGGAGG + Intronic
903553393 1:24175196-24175218 CACTGCCACCAAAGACCTGGAGG + Intronic
904057443 1:27680659-27680681 CCCTCCCATCACAGGCCTGGAGG - Intergenic
904477229 1:30773158-30773180 CAGACCCGGCACTGACGTGGTGG + Intergenic
905345256 1:37306915-37306937 AGCTCCTAGCACAGACCTGGTGG - Intergenic
905797850 1:40825571-40825593 CCCTCCAGCCCCAGACCTGGAGG - Intronic
906371537 1:45258196-45258218 CCCTCCCATCACAGGCCTGGAGG + Intronic
906664377 1:47608718-47608740 CCCTCCCATCACAGGCCTGGAGG - Intergenic
907980266 1:59473539-59473561 CAGTGCAGGCACAGACATGGAGG + Intronic
908020048 1:59889672-59889694 CCCTCCCATCACAGGCCTGGAGG - Intergenic
908746888 1:67384464-67384486 CCCTCCCATCACAGGCCTGGAGG - Intronic
909133403 1:71767741-71767763 TCCTCCCATCACAGACCTGGAGG + Intronic
909369700 1:74869933-74869955 CCCTCCCAACACAAACCTGGTGG + Intergenic
909436329 1:75647065-75647087 CCCTCCCATCACAGGCCTGGAGG + Intergenic
909834068 1:80231398-80231420 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
910726893 1:90349277-90349299 CCCTCCCATCACAGGCCTGGAGG + Intergenic
911007662 1:93243456-93243478 CTCTCCCATCACAGGCCTGGAGG - Intronic
911023090 1:93408374-93408396 CCCTCCCATCACAGACCCGGAGG + Intergenic
911134910 1:94429447-94429469 CGCTCCCATCACAGACCTGGAGG + Intronic
911515829 1:98866800-98866822 CCCTCCCATCACAGGCCTGGAGG - Intergenic
911799069 1:102110523-102110545 CCCTCCCACCACAGACCTGGGGG - Intergenic
911848480 1:102784143-102784165 CCCTCCCATCACAGGCCTGGAGG - Intergenic
912099160 1:106184706-106184728 CCCTCCCATCGCAGACCTGGAGG + Intergenic
912112707 1:106363300-106363322 CCCTCCCATCACAGGCCTGGAGG + Intergenic
912121648 1:106479304-106479326 GCCTCCCATCACAGACCTGGAGG + Intergenic
912279502 1:108298012-108298034 CCCTCCCATCACAGGCCTGGAGG - Intergenic
912288724 1:108396345-108396367 CCCTCCCATCACAGGCCTGGAGG + Intronic
912907133 1:113718842-113718864 CCCTCCCTTCACAGGCCTGGAGG - Intronic
913402175 1:118448689-118448711 CCCTCCCATCACAGGCCTGGGGG + Intergenic
914407241 1:147388869-147388891 CACTCCCGCCACACACCTCTGGG + Intergenic
915037764 1:152942952-152942974 CAAACCTGGCACAGACCTTGGGG + Intergenic
915804386 1:158829094-158829116 CAGTCCCATCACAGGCCTGGAGG - Intergenic
917035496 1:170743301-170743323 CCCTCCCATCACAGGCCTGGAGG - Intergenic
917290797 1:173470776-173470798 CCCTCCCATCACAGGCCTGGGGG + Intergenic
917396675 1:174601250-174601272 CCCTCCCATCACAGGCCTGGAGG - Intronic
918079442 1:181194651-181194673 CTCTCCCGTCACAGGCCTCGAGG + Intergenic
918591957 1:186249934-186249956 CCCTCCCATCACAGGCCTGGAGG - Intergenic
918718191 1:187818361-187818383 CCCTCCCATCACAGGCCTGGAGG - Intergenic
918920080 1:190698157-190698179 CCCTCCCATCACAGGCCTGGTGG + Intergenic
918956767 1:191217875-191217897 CACTCTCATCACAGGCCTGGAGG - Intergenic
919175111 1:194010226-194010248 CCCTCCCATCACAGGCCTGGAGG + Intergenic
919398571 1:197081277-197081299 CACTCCCATTACAGGCCTGGAGG + Intergenic
919554345 1:199031876-199031898 CTCTCCCATCACAGACCTGGAGG - Intergenic
920059971 1:203220524-203220546 TTCTCCCGTCACAGGCCTGGGGG - Intronic
921369638 1:214408246-214408268 CACCCCAAGCACTGACCTGGGGG - Intronic
921386657 1:214576970-214576992 CTCTCCCATCACAGACCTAGAGG + Intergenic
921424309 1:214984680-214984702 CCCTCCCATCACAGGCCTGGAGG + Intergenic
921531210 1:216285181-216285203 CCCTCCCATCACAGGCCTGGAGG + Intronic
921899266 1:220433165-220433187 CATTCCGGGCACACAGCTGGGGG + Intergenic
922586401 1:226737531-226737553 CGCTCCCGGCTCAGCCCCGGAGG + Exonic
922929344 1:229376709-229376731 CACTCACCGCAGAGGCCTGGAGG - Intergenic
923088702 1:230722013-230722035 CCCTCCCATCACAGGCCTGGAGG + Intergenic
923198046 1:231686593-231686615 CCCTCCCATCACAGGCCTGGAGG - Intronic
923339205 1:232993696-232993718 CCCTCCCATCACAGGCCTGGAGG + Intronic
923499252 1:234550835-234550857 CAGTCCCGGATGAGACCTGGAGG - Intergenic
923890984 1:238214640-238214662 CCCACCCATCACAGACCTGGAGG - Intergenic
923919388 1:238546343-238546365 CTCTCCCATCACAGGCCTGGAGG - Intergenic
924050769 1:240078019-240078041 CCCTCCCATCACAGGCCTGGAGG + Intronic
924359138 1:243217791-243217813 CACACCAGGTAGAGACCTGGTGG + Intronic
924511473 1:244731829-244731851 TACTCTGGGCACAGCCCTGGAGG + Intergenic
924806544 1:247366227-247366249 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1063454578 10:6174218-6174240 GACTCCTGGCACAGATCTGCTGG + Intronic
1063481536 10:6380713-6380735 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1065347795 10:24765215-24765237 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1065408088 10:25390870-25390892 CCCTCCCATCACAGGCCTGGAGG + Intronic
1066083444 10:31954969-31954991 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1066451819 10:35536992-35537014 CCCTCCCATCACAGGCCTGGAGG + Intronic
1067373782 10:45709027-45709049 CACACCCTGCACAGACCCTGAGG - Intergenic
1067379901 10:45763205-45763227 CACACCCTGCACAGACCCTGAGG + Intronic
1067562761 10:47315300-47315322 CCATCCAGGCACAGGCCTGGAGG - Intergenic
1067881612 10:50050794-50050816 CACACCCTGCACAGACCCTGAGG - Intergenic
1067887600 10:50103859-50103881 CACACCCTGCACAGACCCTGAGG + Intronic
1068355871 10:55907511-55907533 CCCTTCCATCACAGACCTGGTGG - Intergenic
1068495107 10:57776905-57776927 CCCTCCCATCACAGGCCTGGGGG - Intergenic
1068519081 10:58059595-58059617 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1068519520 10:58063068-58063090 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1068776428 10:60872916-60872938 CATTCCCTCCCCAGACCTGGTGG + Intronic
1068827170 10:61453120-61453142 CACGCCCGGCAGGGTCCTGGGGG - Exonic
1069077410 10:64052461-64052483 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1069166458 10:65166551-65166573 CTCTCCCATCACAGACCTGGAGG - Intergenic
1069754585 10:70765903-70765925 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1070651812 10:78243017-78243039 CCCTCCCATCACAGACCTGGAGG + Intergenic
1070760509 10:79021464-79021486 CACTCCCCGCCCAGATTTGGAGG + Intergenic
1071034816 10:81232788-81232810 CCCTCCCATCACAGACCTGGAGG + Intergenic
1071159256 10:82727298-82727320 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071506931 10:86238236-86238258 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071962714 10:90822714-90822736 CCCTCCCATCACAGGCCTGGAGG + Intronic
1071981067 10:91004631-91004653 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1072035838 10:91561924-91561946 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1072636170 10:97179942-97179964 TAATGCCGGCACAGAACTGGAGG + Intronic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1073883322 10:108008112-108008134 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074041463 10:109793547-109793569 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074042935 10:109810168-109810190 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1074069101 10:110048949-110048971 CCCTCCCATCACAGGCCTGGAGG + Intronic
1074253959 10:111781982-111782004 CATTCCCAGTACAGAGCTGGGGG + Intergenic
1075530598 10:123225651-123225673 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1076209034 10:128625908-128625930 CAGACCGGGGACAGACCTGGGGG + Intergenic
1076824468 10:132960179-132960201 CACCCCAGGCACAGACATGCCGG + Intergenic
1077241219 11:1511344-1511366 CACTGCCCACACAGACCTGTAGG + Intergenic
1077369490 11:2174778-2174800 CACGCTGGGCACAGGCCTGGAGG + Intergenic
1078379749 11:10829393-10829415 CCCTCCCATCACAGACCTGGAGG - Intronic
1078687381 11:13546257-13546279 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1079031129 11:16987260-16987282 CACACCCCCCACTGACCTGGTGG + Intronic
1079521126 11:21328146-21328168 CCCTCCCATCACAGGCCTGGAGG + Intronic
1079856433 11:25610760-25610782 CACTCCCATCACACACCTGGAGG - Intergenic
1080151416 11:29056643-29056665 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1080153329 11:29078505-29078527 CCCTCCCATCACAGCCCTGGAGG + Intergenic
1080422758 11:32126509-32126531 CACTCTCACCACAGACCTGCAGG + Intergenic
1080707639 11:34713119-34713141 CCCTCCCATCACAGACCTGGAGG + Intergenic
1081101456 11:39007235-39007257 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1081309495 11:41553372-41553394 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1081441520 11:43086094-43086116 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1081579622 11:44343369-44343391 CTCTACCTGCCCAGACCTGGAGG + Intergenic
1082010711 11:47448215-47448237 CACTGCAGGCTCAGACCTGGAGG + Intronic
1082119055 11:48358111-48358133 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082615022 11:55349233-55349255 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1082652125 11:55806473-55806495 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1082766235 11:57169945-57169967 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1083136157 11:60678441-60678463 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1083477078 11:62921633-62921655 CACCCACTGCACAGACCCGGCGG + Exonic
1085236449 11:75019328-75019350 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1085754988 11:79194903-79194925 CCCTCCCATCACAGCCCTGGAGG + Intronic
1086185001 11:84002712-84002734 CCCTCCCATGACAGACCTGGAGG - Intronic
1086620621 11:88883691-88883713 CCCTCCCATCACAGGCCTGGAGG + Intronic
1086750678 11:90490018-90490040 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1086764281 11:90675639-90675661 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1086826786 11:91508119-91508141 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1086828820 11:91534297-91534319 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1087336546 11:96851661-96851683 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1087474580 11:98620214-98620236 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1087763621 11:102127269-102127291 CCCTCCCATCACAGGCCTGGAGG + Intronic
1087793592 11:102432716-102432738 CCCTCCCATCACAGGCCTGGAGG + Intronic
1088443907 11:109902210-109902232 CCCTCCCATCACAGTCCTGGGGG - Intergenic
1088953890 11:114598780-114598802 CTCTCCCATCACAGACCTGCAGG - Intergenic
1090756392 11:129795304-129795326 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1091244573 11:134081347-134081369 CCCTCCCATCACAGGCCTGGAGG + Intronic
1091350670 11:134891761-134891783 CCCTCCCATCACAGACTTGGAGG + Intergenic
1091552848 12:1550047-1550069 CCCTCCCATCACAGACCTGGAGG + Intronic
1092184330 12:6467700-6467722 CCCTCCCATCACAGGCCTGGAGG + Intronic
1092618230 12:10234772-10234794 CACTCCCATCACAGGCCTGGAGG - Intergenic
1093038140 12:14352275-14352297 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1093123436 12:15300177-15300199 CCCTCCCGTTACAGGCCTGGAGG - Intronic
1093141894 12:15518380-15518402 CCCTCCCATCACAGGCCTGGAGG - Intronic
1093351051 12:18103464-18103486 CCCTCCCATCACAGGCCTGGAGG - Intronic
1094037020 12:26082261-26082283 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1094254011 12:28400400-28400422 CCCTCTCATCACAGACCTGGAGG - Intronic
1094379908 12:29831391-29831413 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1094777304 12:33745642-33745664 CCCTGCCATCACAGACCTGGAGG + Intergenic
1094785820 12:33847002-33847024 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1095300877 12:40582145-40582167 CACTCCCATCAGAGGCCTGGAGG - Intergenic
1096875535 12:54627455-54627477 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1097184858 12:57191083-57191105 CCGTCCAGGCACAGACATGGTGG + Intronic
1097368068 12:58742152-58742174 CCCTCCCATCACAGACCCGGAGG + Intronic
1097401688 12:59135042-59135064 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1097445588 12:59667791-59667813 CCCTCCCATCACAGGCCTGGAGG + Intronic
1097571305 12:61335382-61335404 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1097575631 12:61389262-61389284 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1097654736 12:62344968-62344990 CCCTCCCATCACAGGCCTGGAGG - Intronic
1097955843 12:65484368-65484390 CCCTCCCATCACAGGCCTGGAGG - Intronic
1098163936 12:67673730-67673752 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1098774845 12:74600093-74600115 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1098836771 12:75433122-75433144 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1099096368 12:78379285-78379307 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1099407411 12:82281470-82281492 CCCTCCCATCACAGGCCTGGAGG + Intronic
1099507714 12:83500045-83500067 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1099675438 12:85755390-85755412 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1099838436 12:87937044-87937066 CCCTCCCATCACAGACCTGGAGG + Intergenic
1101193087 12:102354764-102354786 CCCTTCCATCACAGACCTGGAGG - Intergenic
1101258014 12:102998434-102998456 CTCTCCCATCACAAACCTGGAGG - Intergenic
1101730034 12:107419289-107419311 CCCTCCAGGCACTGACCTGCTGG + Intronic
1101738543 12:107482065-107482087 CACTCCCTGCACAGGCATTGTGG - Intronic
1102668902 12:114600732-114600754 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1102925264 12:116821413-116821435 CAGACCCAGCACCGACCTGGAGG - Intronic
1103223551 12:119267172-119267194 CCCTCCCGTCACAGGCCTGGAGG + Intergenic
1103264535 12:119617965-119617987 CCCTCCCATCACAGGCCTGGAGG + Intronic
1103588386 12:121973051-121973073 CCCTCCCATCACAGTCCTGGAGG + Intronic
1103724673 12:122991752-122991774 CACACTCGGCACAGCCCGGGCGG + Intronic
1103967974 12:124652248-124652270 CTCTCCCATCCCAGACCTGGGGG + Intergenic
1104002233 12:124867332-124867354 GACTGCAGGCAAAGACCTGGAGG + Intronic
1104172147 12:126292210-126292232 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1104226406 12:126838473-126838495 CACTCTCAGCACAGACCTCTGGG - Intergenic
1104240581 12:126985058-126985080 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1104750679 12:131236179-131236201 CTCTCCAGGCACAGACCTTGTGG - Intergenic
1104830052 12:131744090-131744112 CCCTCCCATCACAGGCCTGGAGG - Intronic
1104966117 12:132509485-132509507 CACGCCCGGCCCAGCCCTGCCGG + Intronic
1105008025 12:132735207-132735229 CAGTCCCGTCCCAGACCTGGGGG - Intronic
1105530208 13:21212295-21212317 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1105701650 13:22939349-22939371 CACTCCCTGCAGTGCCCTGGGGG - Intergenic
1105957947 13:25301660-25301682 CTCGCCCGGCACGGACCTGGCGG - Exonic
1106734745 13:32577814-32577836 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1108579771 13:51818462-51818484 GACTCCTGGCAGAGATCTGGGGG + Intergenic
1108770924 13:53699835-53699857 CCCTCCCTTCACAGACCTGGAGG + Intergenic
1108927365 13:55769731-55769753 CCCTCCCATCACAGATCTGGAGG + Intergenic
1108933926 13:55864265-55864287 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1109485291 13:63010336-63010358 CATTCCCATCACAGGCCTGGAGG - Intergenic
1109655698 13:65387904-65387926 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1111065709 13:83089026-83089048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1111442900 13:88304238-88304260 CCCTCCCATCACAGAACTGGAGG + Intergenic
1111615027 13:90652180-90652202 CCCTCCCATCACAGGCCTGGGGG + Intergenic
1112512198 13:100019990-100020012 CATTCCCTTCACAGGCCTGGAGG + Intergenic
1112789578 13:102988111-102988133 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
1112812376 13:103233814-103233836 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1113450274 13:110404523-110404545 CACTCCCGGCACCTCCCTGTTGG - Intronic
1114795727 14:25712742-25712764 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1116263513 14:42660635-42660657 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116281598 14:42915055-42915077 CCCTCCCATTACAGACCTGGAGG - Intergenic
1116387343 14:44348089-44348111 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116625140 14:47254119-47254141 CTCTCCCATCACAGGCCTGGAGG - Intronic
1116670074 14:47829256-47829278 CCCTCCCGTCACAGACCTGGAGG - Intergenic
1116762048 14:49026875-49026897 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116854140 14:49937303-49937325 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1116931393 14:50694488-50694510 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1117234288 14:53754853-53754875 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117256726 14:53985744-53985766 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117854233 14:60010481-60010503 CACTCCCATCACAGGCCTGGAGG - Intronic
1117907463 14:60605494-60605516 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1117908273 14:60612262-60612284 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1117977323 14:61311088-61311110 CCCTCCCACCACAGATCTGGAGG - Intronic
1118957059 14:70491844-70491866 TTCTCCCGTCACAGGCCTGGAGG - Intergenic
1119200517 14:72748610-72748632 CCCTCCCATCACAGGCCTGGAGG + Intronic
1119216401 14:72872248-72872270 CCCTCCCATCACAGGCCTGGAGG - Intronic
1119305830 14:73607463-73607485 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1119450190 14:74702552-74702574 CACTCCCATCACAGACCTGGAGG - Intronic
1119499283 14:75109732-75109754 TATTCCCTGCACAGACCTGCCGG + Exonic
1119862593 14:77947495-77947517 CCATCCCGTCACAGACCTGGAGG + Intergenic
1119963065 14:78881895-78881917 CCCTCCCATCACAAACCTGGAGG + Intronic
1120234585 14:81876020-81876042 CCCTCCCATCACAGATCTGGGGG + Intergenic
1120270612 14:82309367-82309389 CCCTCCCATCACAGGCCTGGCGG + Intergenic
1120326524 14:83036671-83036693 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1120377672 14:83730129-83730151 CCCTCCAATCACAGACCTGGAGG - Intergenic
1120457736 14:84754304-84754326 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1120620179 14:86753162-86753184 CACTCCCATCACAGGCATGGAGG - Intergenic
1120659074 14:87230951-87230973 CCTTCCCATCACAGACCTGGTGG - Intergenic
1120799828 14:88675554-88675576 CCCTCCCATCACAGGCCTGGAGG - Intronic
1120818132 14:88884329-88884351 CCCTCTCATCACAGACCTGGAGG - Intergenic
1121017037 14:90555225-90555247 CACTCCCTACACCAACCTGGGGG + Intronic
1121446868 14:93984244-93984266 CACTCCCAGCACAGACTTGCTGG + Intergenic
1122801724 14:104234118-104234140 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1123138205 14:106050249-106050271 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1123795557 15:23766931-23766953 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG + Intronic
1124509120 15:30307082-30307104 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1124734439 15:32231580-32231602 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1125066142 15:35487635-35487657 CCCTCCCATCACAGGCCTGGAGG - Intronic
1125251751 15:37713207-37713229 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1125472138 15:40014620-40014642 CCCTCCCATCACAGGCCTGGAGG - Intronic
1126100970 15:45117969-45117991 CTCTCCTGGCCCAGGCCTGGCGG - Exonic
1126647960 15:50894139-50894161 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1126825114 15:52540648-52540670 CCCTCCCATCACAGACCTGGAGG - Intergenic
1127773008 15:62245550-62245572 CAGTCACGGCACGGCCCTGGAGG + Intergenic
1128438577 15:67681104-67681126 CACTGCTGGCACAGAGCTAGAGG - Intronic
1129549174 15:76429900-76429922 CCCTCCCATCACAGACCTGGAGG + Intronic
1129738425 15:77978257-77978279 CCCACCCAGCTCAGACCTGGAGG - Intergenic
1129847648 15:78775352-78775374 CCCACCCAGCTCAGACCTGGAGG + Intronic
1130297627 15:82658362-82658384 CACACCTGGAACAAACCTGGTGG - Intergenic
1130600714 15:85271413-85271435 CCCACCCAGCTCAGACCTGGAGG + Intergenic
1130677732 15:85968489-85968511 CACTCAGGGCACACAGCTGGAGG - Intergenic
1131157402 15:90083771-90083793 CACTCAGGGCACAGGCCTGTGGG - Exonic
1131752671 15:95526373-95526395 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1131864496 15:96693003-96693025 CACGGCCGCCACAGAGCTGGCGG - Intergenic
1131980139 15:97986940-97986962 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1132122755 15:99192327-99192349 CCCTCCCATCACAGGCCTGGAGG + Intronic
1132749638 16:1451607-1451629 CACTGCCCACACACACCTGGCGG + Exonic
1134080825 16:11323782-11323804 CGCTCCAGGCATAAACCTGGCGG - Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1136247983 16:28986031-28986053 CACACCCTGGACAGGCCTGGGGG - Intronic
1136424333 16:30159151-30159173 CACACCCAGCACAGACGGGGTGG - Intergenic
1136642338 16:31577566-31577588 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1136654651 16:31702712-31702734 CACTCCCAGCTCAGGACTGGAGG + Intergenic
1137413884 16:48254327-48254349 CACTCCCAGCAGAGAACTGAAGG - Intronic
1138997599 16:62474026-62474048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1139341463 16:66270505-66270527 CACCCCCAGCCCAGCCCTGGCGG - Intergenic
1139930867 16:70524967-70524989 CGCGCCCGGCCCAGACGTGGGGG + Intronic
1141037864 16:80643833-80643855 CCCTCCCATCACAGGCCTGGAGG - Intronic
1142233542 16:88910899-88910921 CACACTTGGCACAGCCCTGGAGG - Intronic
1142302645 16:89267527-89267549 TACTCCCAGGACAGACGTGGTGG - Intergenic
1142840269 17:2623100-2623122 CCCTCCCATCACAGGCCTGGAGG - Intronic
1143210896 17:5186461-5186483 CCCTCCCATCACAGGCCTGGAGG - Intronic
1143557383 17:7670339-7670361 AACTCCCAGCCCAGAGCTGGAGG - Intronic
1144790419 17:17855301-17855323 GACTCCCTCCTCAGACCTGGAGG - Intronic
1145772193 17:27501489-27501511 CTCTCCCATCACAGGCCTGGAGG + Intronic
1146391745 17:32429518-32429540 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1146530972 17:33607421-33607443 CACTCCCTGCACTGATTTGGAGG + Intronic
1147122203 17:38342280-38342302 CACTCCCTTCTCAGGCCTGGGGG + Intronic
1148640711 17:49185264-49185286 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1148745028 17:49913249-49913271 CACTCATGGCACCTACCTGGGGG - Intergenic
1148801029 17:50225922-50225944 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1149052751 17:52325859-52325881 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1149064622 17:52465526-52465548 CCCTCCCGTCACAGGTCTGGAGG + Intergenic
1149079062 17:52632442-52632464 CCCTCCCATCACAGACCTGGAGG + Intergenic
1149341083 17:55687186-55687208 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1150203078 17:63377157-63377179 CCCTCCCATCACAGGCCTGGAGG - Intronic
1150941502 17:69698574-69698596 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1151135788 17:71944878-71944900 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1151930789 17:77230304-77230326 CTCACCTGGCACAGGCCTGGTGG - Intergenic
1152120678 17:78416493-78416515 GACCCCAGGCACAGGCCTGGAGG - Intronic
1152403605 17:80083770-80083792 CACTGGCGGCTCAGACCTGCCGG + Intronic
1152524938 17:80883152-80883174 CAAGACGGGCACAGACCTGGTGG - Intronic
1153011990 18:547573-547595 CCCTCCCATCACAGTCCTGGAGG - Intergenic
1153348400 18:4052556-4052578 CCCTCCCGTCACAGGCCTGGAGG - Intronic
1153539121 18:6135254-6135276 CTCTCCCATCACAGGCCTGGAGG - Intronic
1153556857 18:6323919-6323941 CCCTCCCATCACAGGCCTGGAGG + Intronic
1155530734 18:26763947-26763969 TACTGCCGGCTCAGACCTGATGG - Intergenic
1155632178 18:27906431-27906453 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1156052399 18:32952582-32952604 CCCTCCCGTCACAGGCCTGGAGG - Intronic
1156207942 18:34906300-34906322 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1158833223 18:61303246-61303268 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1159357719 18:67358644-67358666 CTCTCCCATCACAGCCCTGGGGG + Intergenic
1159717925 18:71849053-71849075 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1160599360 18:80001012-80001034 CCCTCCCATCACAGGCCTGGAGG + Intronic
1160605776 18:80048635-80048657 CACATCCGGCACAGGCGTGGAGG - Intronic
1160774466 19:848664-848686 CAGTCCAGGCAGAGACCTGAGGG + Intergenic
1161435425 19:4259949-4259971 CACTACCCACACAGCCCTGGGGG + Intronic
1162060156 19:8090006-8090028 CCTTCCCTGCACACACCTGGGGG - Intronic
1162063665 19:8111663-8111685 CATCCCCGGCAAAGCCCTGGCGG + Exonic
1162556367 19:11388644-11388666 CTCTTCCGGCCCAGACATGGTGG + Intronic
1162590451 19:11587902-11587924 CACGCCCTGCACAGGCCTAGTGG - Intronic
1163365987 19:16876436-16876458 CACTGCCGGCACAGCCCAGCCGG - Intronic
1163374750 19:16923160-16923182 CACTCCCAGCCCAGCCTTGGAGG - Intronic
1163564706 19:18044000-18044022 CACTACCCTCTCAGACCTGGAGG + Intergenic
1163836644 19:19579057-19579079 CACGCCCGGCCCAGACTGGGTGG - Intronic
1164487203 19:28668635-28668657 CATCCCCTGCACAGAGCTGGTGG - Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1168123989 19:54272783-54272805 AACTCCCAGCACAGCCCTGGTGG + Intronic
1168126569 19:54286626-54286648 CACTCCCCGCAGAGACCTCAGGG + Intergenic
1168178377 19:54642751-54642773 AACTCCCAGCACAGCCCTGGTGG - Intronic
1168496167 19:56853636-56853658 CCCTCCCATCACAGGCCTGGAGG + Intergenic
925347292 2:3179901-3179923 CACTCCCAGCCCAGCCCTGTGGG + Intergenic
925498933 2:4483214-4483236 CCCTCCCATCACAGGCCTGGAGG + Intergenic
925527062 2:4814341-4814363 CCCTCCCATCACAGGCCTGGAGG - Intergenic
925805200 2:7641485-7641507 CTCTCCCATCACAGGCCTGGAGG - Intergenic
926500184 2:13643798-13643820 CACTACTATCACAGACCTGGAGG + Intergenic
926508085 2:13740869-13740891 CCCTCCCATCACAGGCCTGGAGG + Intergenic
926768970 2:16351286-16351308 CCCTCCCATCACAGGCCTGGAGG + Intergenic
926929659 2:18024014-18024036 CCCTCCCATCACAGGCCTGGAGG - Intronic
926947400 2:18203323-18203345 CTCTTCCATCACAGACCTGGAGG + Intronic
927033820 2:19150962-19150984 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
927341940 2:21992582-21992604 CCCTCCCATCACAGGCCTGGAGG - Intergenic
927438259 2:23088889-23088911 CCTTCCCATCACAGACCTGGAGG - Intergenic
928804400 2:35132794-35132816 CACTCCCATCACAGGCCTAGAGG - Intergenic
928812761 2:35248773-35248795 CACTCCCATCACAGACCCAGAGG - Intergenic
929081555 2:38127421-38127443 CCCTCCCATCACAGGCCTGGAGG + Intergenic
929211300 2:39359910-39359932 CCCTCCCATCACAGCCCTGGAGG - Intronic
929358069 2:41050568-41050590 CCCTCCCATCACAGGCCTGGAGG + Intergenic
931949884 2:67350350-67350372 CCCTCCCATCACAGGCCTGGAGG - Intergenic
931983715 2:67721699-67721721 CCCTCCCATCACAGGCCTGGAGG + Intergenic
932923268 2:75941746-75941768 CCCTCCCATCACAGGCCTGGAGG + Intergenic
932956437 2:76356970-76356992 CCCTCCCATCACAGGCCTGGAGG + Intergenic
933047549 2:77558028-77558050 CCCTCCCATCACAGGCCTGGAGG + Intronic
933085067 2:78045879-78045901 CCCTCCCATAACAGACCTGGAGG + Intergenic
933439841 2:82298049-82298071 CCCTCCCATCATAGACCTGGAGG - Intergenic
933578146 2:84093048-84093070 CCCTCCCATCACAGGCCTGGAGG - Intergenic
933790715 2:85881925-85881947 CCCTCCCATCACAGGCCTGGAGG + Intronic
934106960 2:88703649-88703671 CCCTCCCATCACACACCTGGAGG - Intronic
935707731 2:105871064-105871086 CACTGCAGACACAGGCCTGGAGG + Intronic
936014557 2:108947765-108947787 CTCTCCCACCACAGACCCGGAGG - Intronic
936499596 2:113055400-113055422 CCCTCCCATCACAGACCTGGAGG - Intergenic
936831866 2:116656266-116656288 CCCTCCCATCACAGGCCTGGAGG - Intergenic
937008883 2:118543918-118543940 CCCTCCCATCACAGGCCTGGAGG + Intergenic
937380698 2:121374064-121374086 CCCTCCCATCACAGACCTGGAGG + Intronic
937463328 2:122108383-122108405 CACTCCAGGGGCAGCCCTGGCGG + Intergenic
937561041 2:123223994-123224016 CCCTCCCATCACAGGCCTGGAGG - Intergenic
937620558 2:123980449-123980471 CCCTCCCATCACAGACCTGGAGG + Intergenic
938698117 2:133853052-133853074 CCCTCCCATCACAGGCCTGGAGG + Intergenic
938732820 2:134159742-134159764 CACTCCCGCCCCAGAGGTGGAGG + Intronic
938849969 2:135250499-135250521 CCCTCCCGTCACAGGCCAGGAGG + Intronic
938868903 2:135453266-135453288 CCCTCCCATCACAGGCCTGGAGG - Intronic
938936901 2:136135140-136135162 CACTCCTGGCCCAGGCGTGGAGG - Intergenic
939037352 2:137148985-137149007 CCCTCCCATCACAGGCCTGGAGG + Intronic
939137675 2:138315856-138315878 CCCTCCCATCACAGGCCTGGAGG - Intergenic
939224968 2:139353632-139353654 CCCTCCCATCACAGGCCTGGAGG + Intergenic
939578047 2:143919413-143919435 CCCTCCCATCACAGGCCTGGAGG + Intergenic
939667068 2:144965335-144965357 CCCTCCCATCACAGGCCTGGAGG + Intergenic
940408741 2:153335828-153335850 CCCTCCCATCACGGACCTGGAGG + Intergenic
940533152 2:154905128-154905150 CGCTCCCATCACAGGCCTGGAGG - Intergenic
940543030 2:155046069-155046091 CCCTCCCATCACAGGCCTGGAGG - Intergenic
940826300 2:158416248-158416270 CCCTCCCATCACAGCCCTGGAGG - Intronic
941303201 2:163829090-163829112 CCCTCCCATCACAGGCCTGGAGG - Intergenic
941560253 2:167035789-167035811 CTCTCCCATCACAGATCTGGAGG + Intronic
942203294 2:173593325-173593347 CCCTCCCATCACAGGCCTGGAGG - Intergenic
942387777 2:175460565-175460587 CCCTCCCATCACAGGCCTGGAGG + Intergenic
942724801 2:178994521-178994543 CCCTCCCATCACAGGCCTGGAGG - Intronic
942908025 2:181206775-181206797 CCCTCCCATTACAGACCTGGAGG - Intergenic
943004795 2:182376053-182376075 CCCTCCCATTACAGACCTGGAGG - Intronic
943423282 2:187697551-187697573 CCCTCCCATCACAGACCTGGAGG + Intergenic
943543326 2:189244083-189244105 CCCTCCCATCACAGGCCTGGAGG - Intergenic
943620274 2:190140701-190140723 CCCTCCCATCACAGGCCTGGAGG - Intronic
943880092 2:193131829-193131851 CCCTCTCATCACAGACCTGGAGG - Intergenic
943944677 2:194044414-194044436 CCCTCCCATCACAGGCCTGGAGG + Intergenic
944010195 2:194965351-194965373 CCCTCCCATCACAGACCTGGAGG - Intergenic
944303897 2:198157474-198157496 TCCTCCCATCACAGACCTGGAGG + Intronic
945166688 2:206954073-206954095 CCCTCCCATCACAGGCCTGGAGG - Intronic
945534018 2:210989584-210989606 CCCTCCCATCACAGGCCTGGAGG + Intergenic
945618644 2:212106683-212106705 CCCTCCCATCACAGGCCTGGAGG + Intronic
946071404 2:217037206-217037228 CACTCTCAGCACAGGCCTGTGGG - Intergenic
946200401 2:218068065-218068087 GCCTCCCAGCTCAGACCTGGAGG + Intronic
946562526 2:220928525-220928547 CTCTCCCATCACAGACCTAGAGG - Intergenic
946732294 2:222721041-222721063 CCCTCCCATCACAGGCCTGGAGG - Intergenic
947488237 2:230571717-230571739 CCCTCCCATCACAGGCCTGGAGG - Intergenic
947893480 2:233646263-233646285 CCCTCCCATCACAGGCCTGGAGG - Intronic
947903059 2:233738900-233738922 CCCTCCCATCACAGGCCTGGAGG + Intronic
947904476 2:233750565-233750587 CCCTCCCATCACAGGCCTGGAGG + Intronic
948773138 2:240262681-240262703 CCCTCCCATCACAGGCCTGGAGG + Intergenic
948773949 2:240270377-240270399 CACTCTTGGCACAGACCTCTAGG - Intergenic
1170310026 20:14982453-14982475 CCCTCCCATCACAGGCCTGGAGG + Intronic
1170741771 20:19064941-19064963 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1170750394 20:19139795-19139817 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1171001928 20:21423547-21423569 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1171399632 20:24864593-24864615 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1171893227 20:30736017-30736039 CACTCCCAGCACACCTCTGGCGG + Intergenic
1172812037 20:37654978-37655000 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1175195425 20:57239939-57239961 CCCTCCCATCACAGGCCTGGAGG - Intronic
1175418652 20:58817579-58817601 CACTCCTGGCACACAGCTGCGGG + Intergenic
1175937984 20:62523743-62523765 GGCTCCGGGCACAGACATGGGGG - Intergenic
1176073804 20:63239512-63239534 CACACTCAGCACAGACCAGGTGG - Exonic
1176303861 21:5113488-5113510 CACTCGCTGCACAGATCTCGAGG - Intergenic
1177067903 21:16463854-16463876 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1177139652 21:17344517-17344539 CTCTCCCACCACAGGCCTGGAGG + Intergenic
1177478112 21:21650871-21650893 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1177528992 21:22336704-22336726 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1178011377 21:28290420-28290442 CACTCCCATCATAGGCCTGGAGG - Intergenic
1178173941 21:30075681-30075703 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1179332030 21:40412845-40412867 CCCTCCCATCACAGACCTGAAGG + Intronic
1179643567 21:42762092-42762114 CAATGCCCGCACAGAGCTGGCGG + Exonic
1179853169 21:44148462-44148484 CACTCGCTGCACAGATCTCGAGG + Intergenic
1180153393 21:45964784-45964806 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1180215257 21:46319346-46319368 CACACCCTCCACAGATCTGGAGG - Intronic
1180540917 22:16446887-16446909 CCCTCCCGTCACAGAGTTGGAGG - Intergenic
1181274810 22:21681716-21681738 CACTCCCCTCACAGCCCTAGAGG - Intronic
1181614571 22:24044210-24044232 CACTCCCATCACAGACCAAGAGG - Intronic
1182945259 22:34316075-34316097 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1183739736 22:39662988-39663010 CCCTCCCGGCCCAGAGGTGGGGG + Intronic
1184311885 22:43651161-43651183 CCCTCCCATCACAGGCCTGGAGG + Intronic
1184504465 22:44892577-44892599 CACACCAGGCACTGACCTCGGGG + Intronic
1184713305 22:46265798-46265820 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1185240442 22:49740364-49740386 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
950517919 3:13479738-13479760 CACTCCCGGCGAAGACATGTAGG - Intronic
950660964 3:14466799-14466821 CACACCCGCCACAGGCCCGGTGG - Intronic
951358996 3:21702443-21702465 CCCTCCCATCACAGGCCTGGAGG - Intronic
951446193 3:22782846-22782868 CGCTCCCATCACAGGCCTGGAGG - Intergenic
951756496 3:26096667-26096689 CCCTCCCATCACAGGCCTGGAGG - Intergenic
951861129 3:27253923-27253945 CATTCCAGGCAGAGAGCTGGAGG - Intronic
951865092 3:27299134-27299156 CCCTCCCATCACAGGCCTGGAGG + Intronic
952029063 3:29119675-29119697 CACTCCCATCACAGACCTGGAGG + Intergenic
952198539 3:31101443-31101465 CCCTCCCATCACACACCTGGAGG - Intergenic
952202705 3:31147757-31147779 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
952569967 3:34702074-34702096 CCCTCCCATCACAGACCTAGAGG - Intergenic
952608771 3:35181822-35181844 CCCTCCCATCACAGACCTGGAGG - Intergenic
952715132 3:36472320-36472342 CCCTCCCATCACAGGCCTGGAGG - Intronic
953898541 3:46823543-46823565 CCCTCCCATCACAGGCCTGGAGG - Intergenic
954422000 3:50423776-50423798 GCCTCCTGGCACAGGCCTGGGGG - Intronic
954618576 3:51983185-51983207 AGCTCCCGGCGCATACCTGGGGG + Exonic
956169585 3:66422119-66422141 CCCTCCCATCACAGGCCTGGAGG - Intronic
956185728 3:66560123-66560145 CCCTCCCATCACAGGCCTGGAGG - Intergenic
956391599 3:68779437-68779459 CCCTCCCATCACAGGCCTGGAGG + Intronic
956474919 3:69609815-69609837 CCCTCCCATCACAGGCCTGGAGG + Intergenic
956551163 3:70461434-70461456 CTCTCCCATCACAGACCCGGAGG + Intergenic
957524087 3:81357955-81357977 CCCTCCCATCACAGGCCTGGAGG + Intergenic
958057120 3:88427506-88427528 CCCTCCCATCACAGGCCTGGGGG + Intergenic
958543399 3:95509849-95509871 CCCTCCCATCACAGACCTGGAGG + Intergenic
958550635 3:95607493-95607515 CCCTCCCAGCACAGACCCAGAGG - Intergenic
958583869 3:96061351-96061373 CCCTCCTATCACAGACCTGGAGG + Intergenic
958893489 3:99805381-99805403 CCCTCCCATCACAGGCCTGGAGG - Intergenic
959140990 3:102486757-102486779 CCCTCCCATCACAGGCCTGGAGG + Intergenic
959342588 3:105149437-105149459 CTCTCCCATCACAGGCCTGGAGG - Intergenic
959851764 3:111096558-111096580 CCCTCCCATCACAGGCCTGGAGG + Intronic
960021774 3:112963845-112963867 CCCTCCCATCACAGGCCTGGAGG + Intronic
960060180 3:113312612-113312634 CCCTCCCATCACAGGCCTGGAGG + Intronic
960538486 3:118839365-118839387 CCCTCCCGTCACAGGCTTGGAGG - Intergenic
960541918 3:118871183-118871205 CCCTCCCATCACAGACCTGGAGG + Intergenic
960563896 3:119114109-119114131 CCCTCCCATCACAGGCCTGGAGG - Intronic
960599899 3:119446392-119446414 CATGCACGGCACAGACATGGTGG + Intronic
960842889 3:121978445-121978467 CCCTCCCATCACAGACATGGAGG + Intergenic
961029754 3:123591184-123591206 CCCTCCCATCACAGACCTAGAGG - Intergenic
961804282 3:129477585-129477607 CACTCCCACTACAGACCAGGTGG - Intronic
961961927 3:130864563-130864585 CCCTCCCATCACAGGCCTGGAGG + Intronic
962162222 3:133011915-133011937 CCCTCCCATCACAGGCCTGGAGG - Intergenic
962339539 3:134570116-134570138 CTCTCCCATCACAGGCCTGGAGG - Intronic
962421637 3:135233990-135234012 CCCTCCCATCACAGACCTGGAGG - Intronic
962440241 3:135406550-135406572 CCCTCCCATCACAGGCCTGGAGG - Intergenic
962509433 3:136084140-136084162 CCCTCCCATCACAGGCCTGGAGG + Intronic
962576880 3:136763198-136763220 CCCTCCCATCACAGGCCTGGAGG + Intergenic
962646460 3:137445337-137445359 CTCTCCTGTCACAGGCCTGGAGG - Intergenic
963297062 3:143557992-143558014 CCCTCCCATCACAGGCCTGGAGG + Intronic
963391204 3:144665863-144665885 CCCTCCCATCACAGGCCTGGAGG - Intergenic
963584643 3:147170105-147170127 TCCTCCCATCACAGACCTGGAGG - Intergenic
963593043 3:147286758-147286780 CCCTCCCATCACAGGCCTGGAGG - Intergenic
963683593 3:148410692-148410714 CCCTCCCATCACAGTCCTGGAGG - Intergenic
964737857 3:159934474-159934496 CCCTCCCATCACAGGCCTGGAGG - Intergenic
964792961 3:160470316-160470338 CCCTCCCATCACAGGCCTGGAGG + Intronic
964836114 3:160940412-160940434 CCCTCCCATCACAGGCCTGGAGG + Intronic
964954391 3:162334695-162334717 CACTCCAATCACAGGCCTGGAGG + Intergenic
964978380 3:162647453-162647475 CCCTCCCATCACAGGCCTGGAGG + Intergenic
964989163 3:162785220-162785242 CCCTCCCATCACAGGCCTGGAGG - Intergenic
965146619 3:164913152-164913174 CCCTCCCATCACAGGCCTGGAGG - Intergenic
965265069 3:166532209-166532231 CACTCCTGTCACAGGCTTGGAGG - Intergenic
965499966 3:169445232-169445254 CCCTCCCATCACAGGCCTGGAGG + Intronic
966074996 3:175924965-175924987 CCCTCCCATCACAGGCCTGGAGG - Intergenic
966733802 3:183172737-183172759 CCTTCCTGGCATAGACCTGGGGG - Intergenic
966972765 3:185060795-185060817 CCCTCCCAACACAGGCCTGGAGG + Intergenic
967155033 3:186684169-186684191 CCCTCCCATCACAGATCTGGAGG - Intergenic
967462333 3:189761082-189761104 CTCTCCCATCACAGGCCTGGAGG - Intronic
967513711 3:190341563-190341585 CCCTCCCATCACAGACCTGGAGG - Intronic
967635057 3:191791158-191791180 CCCTCCCATCACAGGCCTGGAGG - Intergenic
967954486 3:194867875-194867897 CACCCCCGCCAGAGACATGGCGG + Intergenic
969406528 4:6996709-6996731 CCCGCCCGGGACAGCCCTGGGGG - Intronic
969694220 4:8725678-8725700 CACTCCCAGCCCAGACCTAGAGG + Intergenic
970047872 4:11876309-11876331 CCCTCCCATCACAGGCCTGGAGG - Intergenic
970157279 4:13153717-13153739 CCCTCCCATCACAGATCTGGAGG - Intergenic
970344074 4:15136190-15136212 CCCTCCCATCACAGGCCTGGAGG - Intergenic
970554266 4:17215396-17215418 CCCTCCCATCACAGGCCTGGAGG - Intergenic
971022026 4:22546474-22546496 CCCTCCCATCACAGACCTGAAGG - Intergenic
971570500 4:28205093-28205115 CCCTCCAATCACAGACCTGGAGG - Intergenic
971753273 4:30678137-30678159 CCCTCCCATCACAGGCCTGGAGG + Intergenic
971793704 4:31199878-31199900 CTCTCCCATCACAGGCCTGGAGG - Intergenic
971857148 4:32058359-32058381 CCTTCCCATCACAGACCTGGAGG - Intergenic
971912372 4:32810536-32810558 CCCTCCCATCACAGGCCTGGGGG - Intergenic
971948641 4:33315138-33315160 CCCTCCCAACACAGGCCTGGAGG + Intergenic
972370600 4:38419650-38419672 CTCTCCCATCACAGGCCTGGAGG - Intergenic
973074390 4:45904321-45904343 CCCTCTCATCACAGACCTGGAGG - Intergenic
973078647 4:45962285-45962307 CGCTCCAGTCACAGGCCTGGAGG - Intergenic
974012988 4:56624498-56624520 CCCTCCCATCACAGGCCTGGAGG + Intergenic
974202830 4:58663156-58663178 CCCTCCCATCACAGGCCTGGAGG - Intergenic
974495010 4:62615124-62615146 CCCTCCCATCACAGGCCTGGAGG - Intergenic
974733562 4:65899974-65899996 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
974872453 4:67660319-67660341 TGCTCCCATCACAGACCTGGAGG + Intronic
975257516 4:72255457-72255479 CCCTCCCATCACAGACCTGGAGG + Intergenic
975350444 4:73339721-73339743 TTCTCCCATCACAGACCTGGAGG - Intergenic
975428628 4:74260163-74260185 CACTCTTGCCACAGACCTGTGGG - Intronic
975507061 4:75149012-75149034 CCCTCCCATCACAGACCTGGAGG - Intergenic
975626952 4:76359958-76359980 CACTCCCCTCACTGGCCTGGAGG + Intronic
975729277 4:77321499-77321521 CCCTCCCATCACAGGCCTGGAGG - Intronic
975952303 4:79788787-79788809 CTCTCCCATCACAGGCCTGGAGG + Intergenic
976000825 4:80371285-80371307 CCCTCCCATCACAGGCCTGGAGG - Intronic
976057047 4:81081221-81081243 CCCTCCCATCACAGGCCTGGAGG + Intergenic
976286477 4:83375731-83375753 CCCTCCCATCACAGGCCTGGAGG - Intergenic
976405655 4:84658361-84658383 CCCTCCCATCACAGGCCTGGAGG - Intergenic
976503182 4:85815165-85815187 CCCTCCCATCACAGTCCTGGAGG - Intronic
976988110 4:91327506-91327528 CCCTCCCATCACAGGCCTGGAGG - Intronic
977063842 4:92288565-92288587 CCCTCCCATCACAGGCCTGGAGG - Intergenic
977512002 4:97973601-97973623 CCCTCCCATCACAGGCCTGGAGG + Intronic
977545006 4:98367062-98367084 CCCTCCCATCACAGGCCTGGAGG + Intronic
977592429 4:98841945-98841967 CCCTCCCATCACAGGCCTGGAGG + Intergenic
978234984 4:106447028-106447050 CCCTCCCACCACAGGCCTGGAGG - Intergenic
978492495 4:109323598-109323620 CCCTCCCATCACAGGCCTGGGGG - Intergenic
978579581 4:110218520-110218542 CCCTCCCATCACAGACCTGGAGG - Intergenic
978654726 4:111051955-111051977 CTCTCCCATCACAGACCTGGAGG + Intergenic
978939022 4:114415312-114415334 CCCTCCCATCACAGGCCTGGAGG + Intergenic
978991200 4:115084503-115084525 CCCTCCCATCACAGGCCTGGAGG + Intronic
979368054 4:119848515-119848537 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979391951 4:120138388-120138410 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979411427 4:120384415-120384437 CCCTCCCATCACAGGCCTGGAGG + Intergenic
979426455 4:120572797-120572819 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979895892 4:126156734-126156756 CCCTCCCATCACAGGCCTGGAGG - Intergenic
979895912 4:126156828-126156850 CCCTCCCATCACAGGCCTGGAGG - Intergenic
980083655 4:128369458-128369480 CTCTCCCATCACAGGCCTGGAGG - Intergenic
980202739 4:129677075-129677097 CTCTCCCATCACAGGCCTGGAGG + Intergenic
980346798 4:131633012-131633034 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980458247 4:133073038-133073060 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980596487 4:134962132-134962154 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980702766 4:136454618-136454640 CCCTCCCATCACAGGCCTGGAGG + Intergenic
980891467 4:138819485-138819507 CTCTCCGGGCCCAGACCTGGTGG + Intergenic
980964899 4:139511867-139511889 CATTCCCGGGCCAGACCAGGAGG + Intronic
981356916 4:143799415-143799437 CCCTCCCATCACAGGCCTGGAGG - Intergenic
981378243 4:144040297-144040319 CACTCCCATCACAGGCCTGGAGG - Intergenic
981698644 4:147583945-147583967 CACTCCTACCACAGACCTAGGGG - Intergenic
981861447 4:149361433-149361455 CCCTCCCATCACAGGCCTGGAGG + Intergenic
981862857 4:149378862-149378884 CCCTCCCATCACAAACCTGGAGG + Intergenic
982089391 4:151867365-151867387 CACTCCTGGGACATCCCTGGTGG - Intergenic
982162843 4:152587270-152587292 CCCTCCCATCACAGACCTGGAGG + Intergenic
982299836 4:153867537-153867559 CTCTCCCATCACAGGCCTGGAGG + Intergenic
982829604 4:160043462-160043484 CCCTCCCATCACAGGCCTGGAGG - Intergenic
982917260 4:161227699-161227721 CCCTCCCATCACAGGCCTGGAGG - Intergenic
983006350 4:162490198-162490220 CACTCCCATCACAGGCCTGGAGG + Intergenic
983379073 4:166968375-166968397 CTCTCCCATCACAGGCCTGGAGG + Intronic
983657553 4:170098431-170098453 CCCTCCCATCACAGGCCTGGAGG - Intergenic
983825088 4:172249546-172249568 CCCTCCCATCACAAACCTGGAGG + Intronic
983886750 4:172988634-172988656 CTCTCCCATCACAGGCCTGGAGG + Intronic
983999122 4:174218625-174218647 CCCTCCCCACACACACCTGGAGG + Intergenic
984026279 4:174547386-174547408 CCCTCCTATCACAGACCTGGAGG + Intergenic
984318609 4:178161526-178161548 CTCTCCCATCACAGGCCTGGGGG - Intergenic
984699851 4:182811864-182811886 CCCTCCCATCACAGGCCTGGAGG - Intergenic
985220267 4:187696783-187696805 CCCTCCCATCACAGGCCTGGAGG + Intergenic
985371699 4:189292149-189292171 CCCTCCCATCACAGGCCTGGAGG + Intergenic
985381950 4:189404404-189404426 TGCTCCCATCACAGACCTGGAGG + Intergenic
985607658 5:867009-867031 CACTGCCATCACAGGCCTGGGGG + Intronic
985809137 5:2070426-2070448 CCCTCCCATCACAGGCCTGGAGG + Intergenic
986280800 5:6320840-6320862 CTCTCCCTGCACAGACTTGGAGG - Intergenic
986397188 5:7342919-7342941 CTCTCCTGTCACAGACCCGGAGG + Intergenic
986444688 5:7811113-7811135 TACTCCCGGAACAGACAGGGAGG + Intronic
986852405 5:11829351-11829373 CACTCCCATCACAGGCCAGGAGG + Intronic
987085218 5:14461587-14461609 CCCTCCTGGCCCAGGCCTGGGGG - Intronic
987201759 5:15584189-15584211 CCCTCCCATCACAGGCCTGGAGG - Intronic
987216619 5:15744047-15744069 CCCTCCCTTCACAGGCCTGGAGG - Intronic
987509350 5:18815518-18815540 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
987545952 5:19310138-19310160 CCCTCCCATCACAGGCCTGGAGG - Intergenic
987675003 5:21063288-21063310 CACTCCTATCACAGGCCTGGAGG + Intergenic
987737604 5:21866842-21866864 CCCTCCCATCACAGATCTGGAGG + Intronic
988074823 5:26338933-26338955 CCCTCCCATCACAGGCCTGGAGG - Intergenic
988394398 5:30679085-30679107 CCCTCCCATCACAGGCCTGGAGG + Intergenic
989067844 5:37481623-37481645 CCCTCCCATCACAGGCCTGGAGG - Intronic
989399453 5:40993203-40993225 CCCTTCCATCACAGACCTGGAGG - Intergenic
989787120 5:45345282-45345304 CCCTCCCATCACAGACCTGGAGG - Intronic
990075795 5:51844135-51844157 CCCTCCCATCACAGACCTGGAGG - Intergenic
990083356 5:51944629-51944651 CTCTCCCATCACAGGCCTGGAGG + Intergenic
990135985 5:52644910-52644932 CACTCACCTCACAGGCCTGGAGG + Intergenic
990213764 5:53508322-53508344 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
990291209 5:54354065-54354087 CCCTCCCATCACAGGCCTGGAGG + Intergenic
990526030 5:56628798-56628820 CCCTCCCATCACAGGCCTGGAGG + Intergenic
990903632 5:60779648-60779670 CCCTCCCGTCACAGACCTGGAGG - Intronic
991116895 5:62964642-62964664 CCCTCCCATCACAGGCCTGGAGG - Intergenic
991122500 5:63032466-63032488 CCCTCCCATCACAGGCCTGGAGG + Intergenic
991136215 5:63185562-63185584 CCCTCCCATCATAGACCTGGAGG + Intergenic
991340369 5:65601967-65601989 CCCTCCCATCACAGGCCTGGAGG - Intronic
991355798 5:65767509-65767531 CCCTCCCATCACAGGCCTGGAGG - Intronic
992215798 5:74523838-74523860 CCCTCCCATCACAGGCCTGGAGG + Intergenic
992375699 5:76185727-76185749 CTCTCCCATCACAGGCCTGGAGG - Intronic
993098318 5:83506074-83506096 CACTCCCATCATAGGCCTGGAGG - Intronic
993285470 5:85990938-85990960 CCCTCCCATCACAGGCCTGGAGG + Intergenic
994425158 5:99576339-99576361 CCCTCCCATCACAGGCCTGGAGG + Intergenic
994436180 5:99735894-99735916 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994580315 5:101632964-101632986 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994637730 5:102363625-102363647 CACTCCCATCGCAGGCCTGGAGG - Intergenic
994656001 5:102593611-102593633 CCCTCCCATCACAGGCCTGGAGG - Intergenic
994936017 5:106254973-106254995 CCCTCCCATCACAGGCCTGGGGG + Intergenic
995055363 5:107753578-107753600 CCCTCCCATCACAGGCCTGGAGG + Intergenic
995120708 5:108532738-108532760 CCTTCCCATCACAGACCTGGAGG - Intergenic
995370180 5:111409484-111409506 CCCTCCCATCACAGGCCTGGAGG - Intronic
995389699 5:111626924-111626946 CCCTCCCATCACAGAACTGGAGG + Intergenic
996030974 5:118703453-118703475 CCCTCCCATCACAGGCCTGGAGG - Intergenic
996605278 5:125313806-125313828 CCCTCCCATCACAGGCCTGGAGG - Intergenic
996670557 5:126112998-126113020 CCCTCCCATCACAGGCCTGGAGG + Intergenic
997016263 5:129938277-129938299 CCCTCCCATCACAGGCCTGGAGG - Intronic
997081664 5:130746801-130746823 CCCTCCCATCACAGGCCTGGAGG + Intergenic
997108281 5:131046146-131046168 CCCTCCCATCACAGGCCTGGAGG - Intergenic
997181460 5:131832920-131832942 CCCTCCCATCACAGGCCTGGAGG - Intronic
997182349 5:131843207-131843229 CCCTCCCATCACAGGCCTGGAGG - Intronic
997605080 5:135169110-135169132 CACTTCTGGAACAGAGCTGGGGG + Intronic
998144620 5:139720118-139720140 CTCTCCCATCACAGGCCTGGAGG + Intergenic
998813980 5:145993752-145993774 CCCTCCCATCACAGGCCTGGAGG - Intronic
998980516 5:147697516-147697538 CTCTCCCATCACAGGCCTGGAGG + Intronic
999107972 5:149090807-149090829 CTCTCCCATCACAGACCTGCAGG + Intergenic
1000226476 5:159266641-159266663 CCCTCCCAGCACAGGCCCGGAGG + Intronic
1000609580 5:163359684-163359706 TCCTCCCATCACAGACCTGGAGG + Intergenic
1000777922 5:165442409-165442431 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1003401800 6:5796593-5796615 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1003798281 6:9630686-9630708 CCCTCCCATCACAGACCTAGAGG + Intronic
1005982943 6:30851522-30851544 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1006344110 6:33466233-33466255 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1007327473 6:41073261-41073283 CACTCCCGGCCGAGGCCTGCAGG + Intronic
1007975321 6:46095189-46095211 CCGTCCCATCACAGACCTGGAGG - Intergenic
1008220913 6:48852463-48852485 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1008261043 6:49366770-49366792 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1008756086 6:54797077-54797099 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1008859619 6:56133636-56133658 CCCTCCCATCACAGGCCTGGAGG + Intronic
1009346059 6:62614111-62614133 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1009527433 6:64764521-64764543 CCCTCCCATCACAGGCCTGGAGG - Intronic
1009547023 6:65033417-65033439 CACTCCCATCACAGGCCAGGAGG + Intronic
1009645254 6:66393847-66393869 CTCTCTCATCACAGACCTGGAGG - Intergenic
1009792339 6:68419861-68419883 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1010263702 6:73844844-73844866 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1010611824 6:77962861-77962883 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1010645889 6:78387080-78387102 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1010651071 6:78455845-78455867 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1010735901 6:79443325-79443347 CCCTCCCATCACAGACCTGGAGG - Intergenic
1010978374 6:82341568-82341590 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1011041113 6:83031726-83031748 CCCTCCCATCACAGGCCTGGAGG + Intronic
1011088567 6:83570521-83570543 CCCTCTCATCACAGACCTGGAGG + Intronic
1011110582 6:83833450-83833472 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1011218928 6:85033782-85033804 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1011294132 6:85808466-85808488 CCCTCCCATCACAGATCTGGAGG - Intergenic
1011883376 6:92059718-92059740 CCCTCCCATCAAAGACCTGGAGG + Intergenic
1012019913 6:93905319-93905341 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1012070264 6:94604937-94604959 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1012141454 6:95631434-95631456 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1012161370 6:95888997-95889019 CACTCCCATCACAGTCCTGGAGG - Intergenic
1012723818 6:102783554-102783576 CCCTCCCATCACAGACCTGGAGG + Intergenic
1012762243 6:103317290-103317312 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1012780126 6:103546986-103547008 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1012823808 6:104123446-104123468 CCCTCCCATCACAGACCTGGAGG + Intergenic
1013076974 6:106780521-106780543 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013086598 6:106863006-106863028 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013149007 6:107426104-107426126 CCCTCCCATCACAGGCCTGGAGG + Intronic
1013338625 6:109191521-109191543 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1013793464 6:113859603-113859625 CACTCCCGGTCCAGGGCTGGGGG + Intronic
1013829580 6:114255850-114255872 CCCTCCCAGCACAGGCCTGGAGG - Intronic
1013927913 6:115494773-115494795 CCTTCCCGTCACAGGCCTGGAGG - Intergenic
1014042917 6:116850557-116850579 CCCTCCCCTCACAGGCCTGGAGG + Intergenic
1014342643 6:120228495-120228517 CCCTCCCATCACAGACCTGGAGG - Intergenic
1014407421 6:121068902-121068924 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014562978 6:122913699-122913721 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014691640 6:124570399-124570421 CCCTCCCATCACAGTCCTGGAGG + Intronic
1014714513 6:124848911-124848933 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1014771120 6:125458707-125458729 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1014771750 6:125465460-125465482 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1015868469 6:137752014-137752036 CCCTGCCTGCACAGACCTGGAGG - Intergenic
1016094682 6:140020701-140020723 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1016281818 6:142426998-142427020 CCTTCCCATCACAGACCTGGAGG - Intronic
1016437156 6:144048705-144048727 CCCTCCCATAACAGACCTGGAGG - Intronic
1016595296 6:145791204-145791226 TCCTCCTGTCACAGACCTGGAGG - Intergenic
1017617093 6:156257256-156257278 CACGGCCAGCACACACCTGGAGG + Intergenic
1017626024 6:156349689-156349711 GACTCCCATAACAGACCTGGTGG + Intergenic
1017686918 6:156922922-156922944 CACACGAGCCACAGACCTGGAGG - Intronic
1019150467 6:170002021-170002043 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1019150922 6:170005067-170005089 CTCTCCCATCACAGACCTGTAGG - Intergenic
1021646793 7:22796643-22796665 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1022492937 7:30834487-30834509 CCCTCCCATCACAGACCCGGAGG - Intronic
1024207516 7:47176747-47176769 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1024487121 7:49931784-49931806 CCCTCCCATCACAGGCCTGGAGG + Intronic
1024612984 7:51083118-51083140 TCCTCCCGACACAGACGTGGTGG - Intronic
1024792733 7:52985283-52985305 CCCTCCCCTCACAGAACTGGAGG + Intergenic
1025038517 7:55619059-55619081 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1027586730 7:80066855-80066877 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1027831523 7:83183129-83183151 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1028140996 7:87274508-87274530 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1028207186 7:88031725-88031747 CCCTCCCATCACAGGCCTGGAGG + Intronic
1028516321 7:91681250-91681272 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1028993902 7:97078486-97078508 CACGCCTGGCACAGAGTTGGTGG + Intergenic
1029223683 7:99009468-99009490 CTCTGCCTGCACAGAGCTGGAGG - Intronic
1030357364 7:108557154-108557176 CCCTCCCATCACAGGCCTGGAGG - Intronic
1030527695 7:110673366-110673388 CCCTCCCATCACAGGCCTGGAGG - Intronic
1030986250 7:116245054-116245076 CCCTCCCATCACAGGCCTGGAGG - Intronic
1031055932 7:116992580-116992602 CTCTCTCATCACAGACCTGGAGG - Intronic
1031170854 7:118290690-118290712 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1031182132 7:118432710-118432732 ATCTCCCAGCACAGGCCTGGAGG + Intergenic
1031230218 7:119096112-119096134 CCCTCCCGTTACAGGCCTGGAGG - Intergenic
1031435652 7:121728897-121728919 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1031573071 7:123383264-123383286 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1031608195 7:123794430-123794452 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1032080308 7:128855308-128855330 CACCCTGGGCACAAACCTGGAGG - Exonic
1032318225 7:130860986-130861008 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1033419770 7:141195069-141195091 CCCTCCCATCACAGGCCTGGAGG - Intronic
1033760035 7:144427763-144427785 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1033998778 7:147386194-147386216 CCCTCCCATCACAGGCCTGGAGG - Intronic
1034011279 7:147531649-147531671 CCCTCCCATCACAGGCCTGGAGG - Intronic
1034324692 7:150220141-150220163 CACTCCCTCCACAAACCTGCCGG + Intergenic
1034751286 7:153571369-153571391 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1034751837 7:153576259-153576281 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1034768500 7:153749090-153749112 CACTCCCTCCACAAACCTGCCGG - Intergenic
1034876196 7:154726590-154726612 CCCTCCCATCACAGGCCTGGAGG - Intronic
1035549519 8:509638-509660 CCCTCCCATCACAGGCCTGGAGG - Intronic
1035951857 8:4030584-4030606 CCCTCCCATCACAGGCCTGGAGG - Intronic
1036387674 8:8296145-8296167 CACTCCCAGCAGAGAACAGGGGG - Intergenic
1036690120 8:10939933-10939955 CACTCAGGGGACACACCTGGGGG - Intronic
1037003411 8:13747913-13747935 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1037213898 8:16425723-16425745 CCCTCCCATCACAGGCCTGGAGG + Intronic
1037286212 8:17303399-17303421 CACTCCCGACACAGACTTGATGG - Intronic
1037490341 8:19391566-19391588 CACTCCCAGCTCTTACCTGGAGG + Intronic
1037979159 8:23238252-23238274 CTCTCCCATCACAGACCTGGAGG - Intergenic
1038690715 8:29760643-29760665 CTCTCCCAGCACATACCTGGGGG + Intergenic
1039121900 8:34157270-34157292 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1040287291 8:46106935-46106957 CCCTCCCAGGACAGACCTGGTGG + Intergenic
1040287537 8:46108129-46108151 CACCCCCGGGACACAGCTGGGGG + Intergenic
1040287712 8:46108981-46109003 CCCACCCGGGACAGCCCTGGAGG + Intergenic
1040288719 8:46113477-46113499 CCCACCCGGGACAGCCCTGGGGG + Intergenic
1040295191 8:46145368-46145390 CCCTCCTGGGAAAGACCTGGGGG + Intergenic
1040302789 8:46196607-46196629 CATGCCCGGAACAGAACTGGGGG - Intergenic
1040305203 8:46208416-46208438 CACTCCTGGGACAGCCCTGACGG - Intergenic
1040305707 8:46210719-46210741 CCCATCCGGAACAGACCTGGGGG - Intergenic
1040306792 8:46216152-46216174 CACTCCCGGGACAGTCTTTGGGG - Intergenic
1040308135 8:46222870-46222892 CCCACCCAGGACAGACCTGGGGG - Intergenic
1040308177 8:46223089-46223111 CCCACCCGGGACAGCCCTGGGGG - Intergenic
1040308362 8:46223858-46223880 CCCTCCTGGAACAGTCCTGGGGG - Intergenic
1040308622 8:46225137-46225159 CACGCCCAGGACAGCCCTGGGGG - Intergenic
1040309317 8:46228571-46228593 CACGCCCGGGACAGTCCTGGGGG - Intergenic
1040309546 8:46229651-46229673 CCCACCCGGGAGAGACCTGGGGG - Intergenic
1040310828 8:46235991-46236013 CCCGCCCTGGACAGACCTGGGGG - Intergenic
1040311865 8:46240948-46240970 CCCGCCCGGGACAGACCTGGGGG - Intergenic
1040312759 8:46245238-46245260 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040313286 8:46247861-46247883 CCCACCCGGGACAGACCTGGGGG - Intergenic
1040314842 8:46255461-46255483 CACTCCTGGGACAGTCCTGGAGG - Intergenic
1040315126 8:46256973-46256995 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040325133 8:46337827-46337849 CCTGCCCGGGACAGACCTGGGGG - Intergenic
1040325738 8:46340632-46340654 CCCTCCCCGGACAGCCCTGGGGG - Intergenic
1040326280 8:46343220-46343242 CACGCCAGGGACAGCCCTGGGGG - Intergenic
1040330246 8:46382215-46382237 CCCTCCCCGGACAGACCTGGGGG - Intergenic
1040330385 8:46382863-46382885 CCGGCCCGGGACAGACCTGGAGG - Intergenic
1040332107 8:46390998-46391020 CCCTCCTGGGACAGCCCTGGGGG - Intergenic
1040333358 8:46403635-46403657 CCCTCCCGGCACAGCACTGGGGG - Intergenic
1040334416 8:46408790-46408812 CACCCCCGGGACAGCCCTGAGGG - Intergenic
1040334597 8:46409658-46409680 CCCTCCTGGGACAGCCCTGGGGG - Intergenic
1040335421 8:46413540-46413562 CCCTCCCGGGTCAGCCCTGGGGG - Intergenic
1040335509 8:46413965-46413987 CACACCCAGAACAGCCCTGGTGG - Intergenic
1040335636 8:46414600-46414622 CCTGCCCGGGACAGACCTGGGGG - Intergenic
1040338159 8:46426689-46426711 CACTCCTGGGATAGCCCTGGGGG - Intergenic
1040338920 8:46430108-46430130 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040339357 8:46432656-46432678 CCCTCCAGGGACAGCCCTGGGGG - Intergenic
1040864306 8:52032790-52032812 CATTCTGGGCACAGCCCTGGTGG - Intergenic
1041013796 8:53571009-53571031 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1042602486 8:70512388-70512410 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1042646126 8:70988103-70988125 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1043426058 8:80150022-80150044 CCCTCCCATCACAGGCCTGGAGG + Intronic
1043518510 8:81019382-81019404 CCCTCCCATCACAGGCCTGGAGG + Intronic
1044066611 8:87706501-87706523 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1044220486 8:89663680-89663702 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1044303889 8:90616375-90616397 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1044324881 8:90847887-90847909 CCCTCCCATCACAGGCCTGGAGG - Intronic
1045050540 8:98320230-98320252 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1045053651 8:98349889-98349911 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1045617934 8:103939494-103939516 CCCTCCCATCACAGGCCTGGAGG - Intronic
1045995703 8:108359094-108359116 CACTCCCATCACAGGCCTCGAGG - Intronic
1046170332 8:110497697-110497719 CCCTCCCATCACAGACTTGGAGG + Intergenic
1046226384 8:111285764-111285786 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1046264602 8:111814509-111814531 CCCTCCCATCATAGACCTGGAGG - Intergenic
1046492162 8:114967556-114967578 CACTCCCATCACAGTTCTGGAGG + Intergenic
1046606091 8:116373670-116373692 CCCTCCCAGCACAGACCTGGGGG - Intergenic
1046735116 8:117768556-117768578 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1047923427 8:129658002-129658024 CCCTTCCATCACAGACCTGGAGG - Intergenic
1048360136 8:133690609-133690631 CCCTCCAGGGTCAGACCTGGTGG + Intergenic
1048658535 8:136571174-136571196 CCGTCCCATCACAGACCTGGAGG + Intergenic
1048668383 8:136689759-136689781 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1049076257 8:140398877-140398899 CCCTCCCATCACAGGCCTGGAGG + Intronic
1049238750 8:141525886-141525908 CACCCCAGCCCCAGACCTGGTGG + Intergenic
1049343731 8:142127488-142127510 CACTCCAGGAACAGACTCGGAGG - Intergenic
1049443316 8:142618973-142618995 CAGTGGTGGCACAGACCTGGTGG + Intergenic
1049522597 8:143101910-143101932 GACTCCCGGCACAAGCCTGGTGG - Intergenic
1049805434 8:144536674-144536696 GACCCCTGGCACAGACCTGCTGG + Intronic
1049826387 8:144671546-144671568 CACTCCAGTCACAGAGCTGCCGG + Intergenic
1050674574 9:8037124-8037146 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1051914991 9:22198007-22198029 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1051925170 9:22316786-22316808 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1051984291 9:23063908-23063930 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1052294520 9:26882286-26882308 CCCTCCCATCACAGGCCTGGAGG + Intronic
1052625040 9:30963255-30963277 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1052702224 9:31950938-31950960 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1053616432 9:39770802-39770824 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1054237085 9:62571587-62571609 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1054551224 9:66606098-66606120 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1054797200 9:69313406-69313428 CCCTCCCATCACAGGCCTGGGGG - Intergenic
1055083489 9:72290632-72290654 CCCTCCCATCACAGACCTGGAGG - Intergenic
1055141942 9:72886532-72886554 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1055174467 9:73299948-73299970 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1055990787 9:82102909-82102931 CACTCCTGCCACAGACCTCTGGG - Intergenic
1056012416 9:82346186-82346208 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1056527361 9:87455638-87455660 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1056578040 9:87870736-87870758 CAGCCTCTGCACAGACCTGGCGG - Intergenic
1056670499 9:88623555-88623577 CCCTCCCATCACAGACCTAGAGG - Intergenic
1056924432 9:90820661-90820683 CCCTCCTATCACAGACCTGGAGG - Intronic
1057262037 9:93590418-93590440 CACTCCTGCCCCAGAGCTGGTGG + Intronic
1057266288 9:93620119-93620141 GGCTCCCGGGACAGACCTGCAGG + Intronic
1057645053 9:96866200-96866222 CCCTCCCATCACAGGCCTGGAGG + Intronic
1058637128 9:107048005-107048027 CACTGAAGGCAGAGACCTGGTGG + Intergenic
1058813021 9:108659580-108659602 CCCTCCCCTCACAGGCCTGGAGG + Intergenic
1059187019 9:112283743-112283765 CCCTCCCATCACAGACCTGGAGG + Intronic
1059587301 9:115619914-115619936 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1060622664 9:125082073-125082095 CCCTCCCATCACAGGCCTGGAGG + Intronic
1062438730 9:136559460-136559482 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1062670057 9:137703205-137703227 CCCTCCCATCACAGGCCTGGAGG - Intronic
1186324037 X:8459217-8459239 CTCTCCCTTCACAGGCCTGGAGG - Intergenic
1186700249 X:12083134-12083156 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1186742565 X:12534000-12534022 CCCTCCCATCACAGGCCTGGAGG + Intronic
1187072404 X:15901259-15901281 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1188115027 X:26232144-26232166 CCCTCCCATCACAGATCTGGAGG - Intergenic
1188115642 X:26239107-26239129 CCCTCCTGTCACAGGCCTGGAGG - Intergenic
1188449528 X:30294807-30294829 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1189071349 X:37866881-37866903 CCCTCCCATCACAGGCCTGGAGG - Intronic
1189656435 X:43249619-43249641 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1190506662 X:51133302-51133324 TACTCCAGGCACAGTCCTCGGGG - Intergenic
1191052339 X:56207157-56207179 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1191116467 X:56857989-56858011 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1191688153 X:63913878-63913900 CCCTCCCATCACAGGCCTGGTGG + Intergenic
1191696540 X:63996419-63996441 CCCTCCCGCCACAGGCCTGGAGG + Intergenic
1192132669 X:68567530-68567552 CCCTCCCCTCACAGGCCTGGAGG - Intergenic
1192309382 X:69997655-69997677 CCCTCCCATCACAGGCCTGGAGG + Intronic
1193143570 X:78054649-78054671 CCCTCCCCTCACAAACCTGGAGG - Intergenic
1193188338 X:78539342-78539364 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193221271 X:78929304-78929326 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193250245 X:79281997-79282019 CTCTCCCATCACAGCCCTGGAGG - Intergenic
1193406393 X:81107192-81107214 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1193506274 X:82348333-82348355 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193529897 X:82643422-82643444 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193686190 X:84579957-84579979 TTCTCCCATCACAGACCTGGAGG + Intergenic
1193759229 X:85443473-85443495 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1193850450 X:86531344-86531366 CCCTCCCATCACAGACCTGGAGG + Intronic
1193938538 X:87652214-87652236 CCCTCCCATCACAGGCCTGGAGG - Intronic
1194082953 X:89490412-89490434 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1194145360 X:90255093-90255115 CCCTCCCATCACAGACCTGGAGG - Intergenic
1194216352 X:91134590-91134612 CCCTCCCATCACAGGCCTGGCGG + Intergenic
1194244438 X:91493651-91493673 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1194473914 X:94335404-94335426 TACTCCCTTCACAGGCCTGGAGG + Intergenic
1194876917 X:99201034-99201056 CCCTCCCATCACAGTCCTGGAGG + Intergenic
1195210132 X:102646373-102646395 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1195228091 X:102818492-102818514 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1195814262 X:108867951-108867973 CCCTCCCATCACAGACCTGGAGG - Intergenic
1195863664 X:109407583-109407605 CCCTCCCATCACAGGCCTGGAGG + Intronic
1196173601 X:112616739-112616761 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1196278511 X:113796541-113796563 CCCTCCCATCACAGGCCTGGGGG + Intergenic
1196313552 X:114196832-114196854 CCCTTCCATCACAGACCTGGAGG - Intergenic
1196483577 X:116179627-116179649 CACTCCCATCACAGGCCCGGAGG + Intergenic
1196512827 X:116532360-116532382 CCCTCCCATCGCAGACCTGGAGG - Intergenic
1196566102 X:117206824-117206846 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1196605691 X:117654721-117654743 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1196973916 X:121138172-121138194 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1197223088 X:123932201-123932223 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1197639794 X:128954904-128954926 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1197642844 X:128985948-128985970 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1198176303 X:134159039-134159061 AACTCCCTGCAAAGATCTGGTGG - Intergenic
1198693256 X:139307445-139307467 CCCTCCCATCACAGACCTGGAGG + Intergenic
1198919401 X:141708562-141708584 CCCTCCCAACACAGACCTGGAGG - Intergenic
1198944182 X:141991521-141991543 CCCTCCCGTCACAGGCCAGGAGG + Intergenic
1198956213 X:142134694-142134716 CAGTCCCATTACAGACCTGGAGG + Intergenic
1199070446 X:143469348-143469370 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1199106537 X:143875581-143875603 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199117443 X:144008901-144008923 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1199346541 X:146747157-146747179 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1199389364 X:147261986-147262008 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199393495 X:147307982-147308004 CACTCCCATCACAGACCTGGAGG - Intergenic
1199462606 X:148101026-148101048 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1199472478 X:148210288-148210310 CCCTCCCATCACAGGCCTGGAGG + Intergenic
1200295417 X:154914270-154914292 CCCTCCCATCACAGGCCTGGAGG - Intronic
1200435604 Y:3146285-3146307 CCCTCCCATCACAGGCCTGGAGG - Intergenic
1200491122 Y:3824391-3824413 CCCTCCCATCACAGACCTGGAGG - Intergenic
1200563416 Y:4734948-4734970 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1202047227 Y:20747482-20747504 CACTCACAGCCCAGACATGGAGG - Intergenic