ID: 1124009005

View in Genome Browser
Species Human (GRCh38)
Location 15:25820432-25820454
Sequence CAGGAGAATCAACATCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124009005_1124009009 15 Left 1124009005 15:25820432-25820454 CCATACTGATGTTGATTCTCCTG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1124009009 15:25820470-25820492 CAACTAAAACTCCAAAGTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124009005 Original CRISPR CAGGAGAATCAACATCAGTA TGG (reversed) Intronic
900700232 1:4043735-4043757 GAGGAGAAGCAGCATCAGCATGG - Intergenic
904383012 1:30124238-30124260 CAGCAGCATCCACATCAGTGGGG + Intergenic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
906082590 1:43102956-43102978 CAGGAAAATTAAAATCAGCAGGG - Intergenic
910107447 1:83646752-83646774 ATGGAGAATAAACATGAGTAGGG - Intergenic
911548220 1:99246649-99246671 CAGGAGAATCAACAGAAAAAAGG + Intergenic
914973208 1:152330648-152330670 CAGGAGAATGTAGATCAGGAGGG + Intergenic
915779097 1:158525757-158525779 CAGCAGTATCATCAGCAGTAGGG - Intergenic
916688280 1:167167456-167167478 GAGTAGAGTCAACATCAGAAGGG + Intergenic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
921040945 1:211431438-211431460 CAGCAGAATTAACAGCAGGATGG + Intergenic
921395132 1:214661105-214661127 CAGCAGATTCAACAGCAGTGAGG - Intronic
923316146 1:232781981-232782003 CAGGAGAACCAAAAACAGAAAGG + Intergenic
924492985 1:244558233-244558255 CAGGAGAATCAACTTGAATCTGG - Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1067562523 10:47313956-47313978 CAAGAGATTCAACATAAGTAGGG + Intergenic
1068188309 10:53615923-53615945 CTGGAGAATCTACAACACTAGGG + Intergenic
1068418466 10:56758344-56758366 TAAGAGAATCCACATCAGTGTGG + Intergenic
1068742898 10:60494318-60494340 CAAGAGAATAAACTTCAATATGG + Intronic
1068834336 10:61536166-61536188 CAGGAGAATTAACATCTTAATGG - Intergenic
1069780479 10:70952367-70952389 CAGGAGACTCAGCCTCAGCAGGG - Intergenic
1071710698 10:88046215-88046237 GAGGTGAATTAACATCTGTAAGG + Intergenic
1072159167 10:92750287-92750309 CAGGAGAAGAAACATCTTTAAGG - Intergenic
1077951505 11:6962675-6962697 CAGCAGCATCAACATCTGTTGGG + Intronic
1078165577 11:8881004-8881026 CAGGAGATTCAACATGGGTAAGG - Exonic
1079810010 11:24985949-24985971 CATGAGAAGTAACATGAGTATGG + Intronic
1081253047 11:40859110-40859132 CACAAGAAACAACATCAGTGGGG + Intronic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1082094629 11:48119370-48119392 CAGGAGAATAAACAAGAGAAAGG - Intronic
1086279509 11:85170241-85170263 GAGGAGAAGGAACTTCAGTAAGG + Intronic
1086652550 11:89310591-89310613 CAGGTGAATCAATATGAATAAGG + Intergenic
1087135699 11:94716751-94716773 CACCTGCATCAACATCAGTAGGG - Intronic
1087957712 11:104309490-104309512 AAGGAGAATGAAAATCAGTAAGG + Intergenic
1088371056 11:109088990-109089012 CATGAGAAACCACAGCAGTACGG - Intergenic
1088825718 11:113492127-113492149 GAGGAGAGTCAATATCTGTAGGG - Intergenic
1094255945 12:28426582-28426604 CAGTAGATTCAACATGACTAAGG - Intronic
1094764266 12:33574115-33574137 AAGTAGAACCTACATCAGTAGGG + Intergenic
1095237417 12:39814181-39814203 CAGTACAATCTACATCAGAATGG - Intronic
1096763655 12:53864957-53864979 CAGGAAAAGGAATATCAGTATGG - Intergenic
1097681215 12:62650992-62651014 CAGGATAATAAACATCACTCTGG - Intronic
1098309167 12:69131272-69131294 CAGCAGCATCCACATCAGCAGGG + Intergenic
1099277628 12:80597830-80597852 CAGCAGCATCAACATCACTGGGG - Intronic
1103198391 12:119066466-119066488 CAGCAGAATCAGCATCATTTGGG + Intronic
1104314148 12:127681356-127681378 CAGGATCATCAACATCCATAGGG - Intergenic
1105532957 13:21236817-21236839 CAGCAGTATCAACATCAGCTGGG - Intergenic
1113605986 13:111606606-111606628 CAGGAGCATGAACAGCAGTAAGG - Intronic
1115702420 14:35967342-35967364 AAGGAGAATTAACAACAATAAGG - Intergenic
1119060995 14:71474331-71474353 CAGCAGAATCACCGTCAGTTTGG - Intronic
1119084216 14:71725062-71725084 CAGAAGAATAAACAGCTGTAGGG - Intronic
1123883466 15:24697934-24697956 CAGCAGACACAAAATCAGTAAGG - Intergenic
1124009005 15:25820432-25820454 CAGGAGAATCAACATCAGTATGG - Intronic
1126608336 15:50503335-50503357 CAGGAAATTTAACAACAGTATGG + Exonic
1130100681 15:80891524-80891546 CAGAAGATTCAACAGCAGTGTGG + Intronic
1130879810 15:88045307-88045329 CAGGACAATCAACAGCAGGATGG - Intronic
1131417043 15:92269176-92269198 CAGGAGCATCAGGATCAGTTGGG - Intergenic
1138467644 16:57203697-57203719 TAGGAGAATAAAGATGAGTAAGG - Intronic
1140986944 16:80166997-80167019 CAGCAGAAACAACATCAGCCAGG + Intergenic
1141424211 16:83934920-83934942 CTGGAGACACAACATCAGAAGGG - Intronic
1142522608 17:515738-515760 AAGAAGAATCCTCATCAGTATGG + Exonic
1142772699 17:2110812-2110834 CAGAGGAATCAATATCAGGAGGG + Intronic
1148250170 17:46071249-46071271 CAAGAGCATAAACATCAGAAAGG + Intronic
1149770144 17:59314315-59314337 CAGGAGGATCATCAGCAGTCAGG + Intergenic
1150002556 17:61451178-61451200 CAGCAGAATCCTCATCAATAAGG - Intergenic
1151522775 17:74642326-74642348 CAGGACTAGCAACAGCAGTAGGG + Intergenic
1160116090 18:76080986-76081008 CTGGAGAAGCAACATGAGTTGGG + Intergenic
1164561399 19:29294637-29294659 CAGGAGAATCCACTACTGTATGG + Intergenic
1165908879 19:39211681-39211703 CAGGAGATTCAAGTTCAGTCTGG - Intergenic
1166058070 19:40305726-40305748 CAGGAGAAAAAACAGCAATAAGG + Intergenic
1168479566 19:56707729-56707751 CAGGAGAATCATCTCCATTAGGG + Intergenic
926340047 2:11897952-11897974 CAGGAGAAAAAAAATCAGTGAGG + Intergenic
928256429 2:29726962-29726984 CAGGAGAATCATCACCTGCAAGG - Intronic
930578150 2:53177584-53177606 AAGGAGAATAAACAGCTGTAAGG - Intergenic
932055062 2:68434980-68435002 GAGGAGCATCAAGATCAGTATGG + Intergenic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
937191452 2:120104192-120104214 CAGGAAAATGAACATCATGACGG - Intronic
938547452 2:132347587-132347609 CAGCAAAACAAACATCAGTATGG - Intergenic
941384472 2:164836874-164836896 CAAGAGAATTAAAATCAGAATGG + Intronic
942302179 2:174572455-174572477 CAGGAAAACAAACATCAGTTAGG + Intronic
945051969 2:205832587-205832609 GAGGAGAATCAACAGCAGAATGG + Intergenic
946059004 2:216925815-216925837 CAAGTGAATAAACATCAGTTTGG + Intergenic
947783020 2:232787168-232787190 AAGGTGGACCAACATCAGTAGGG + Exonic
1169551567 20:6706900-6706922 CAGGAAAATAAAAATCAGCATGG - Intergenic
1169783773 20:9336590-9336612 CAGCAGCATCAACATCAGCTGGG - Intronic
1170321228 20:15100232-15100254 CAGGTGAACCATCATCAGTTGGG - Intronic
1171876318 20:30580342-30580364 CAGCAAAACGAACATCAGTATGG - Intergenic
1172489824 20:35327095-35327117 CAGGAACCTCAAGATCAGTAAGG - Intronic
1173113322 20:40216815-40216837 CAGGGTAATGAACATCAGTGGGG - Intergenic
1173725513 20:45294417-45294439 CAGGAGCATCAGCATCATTTGGG - Intronic
1174709265 20:52687420-52687442 CAGGAGCATCAGCATCAGCTGGG - Intergenic
1175223483 20:57431482-57431504 CAGGACAATCAGCAACACTAAGG - Intergenic
1177144897 21:17396944-17396966 AAGGAGATTCAACATGAGAAAGG + Intergenic
1177813724 21:25952890-25952912 TTGGAGAATAGACATCAGTAAGG - Intronic
1178740671 21:35197576-35197598 TAAGAGAATCAACACCAATAAGG + Intronic
1180647683 22:17353042-17353064 CACTAGGTTCAACATCAGTATGG - Intergenic
1182570807 22:31236397-31236419 CAGGAGTTTCAAGATCAGTCTGG + Intronic
954519269 3:51208958-51208980 CAGGAGAATAAATATCTGTAGGG - Intronic
957222730 3:77404948-77404970 TGGGAGAAACAACATCAGTTGGG - Intronic
958958614 3:100488114-100488136 CAGGGGAACCCACATCAGTGGGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
965603721 3:170479620-170479642 CAGGAGAGAGAAAATCAGTAAGG + Intronic
967488292 3:190059238-190059260 CAAGAAACTCACCATCAGTAGGG - Intronic
970525059 4:16923882-16923904 CAGGAGGATAATCATCAGGACGG - Intergenic
973741942 4:53926747-53926769 AAGGAAAATCAACTTCAGCAAGG + Intronic
974587991 4:63904904-63904926 AATGAGAAACCACATCAGTAAGG - Intergenic
974636643 4:64572416-64572438 CTGAAGAAACAACAGCAGTAGGG - Intergenic
974930637 4:68357229-68357251 TAGGAAAATAAACCTCAGTATGG - Intergenic
975569393 4:75797956-75797978 TAGGAGACTCAACATCACAAAGG - Intronic
976012425 4:80507098-80507120 CAGGAGAATCAGCATTTCTAGGG - Intronic
978196300 4:105976207-105976229 CAGCAGCTTCAACATCACTAGGG + Intronic
979011751 4:115379516-115379538 CAGGAGCATCAATATCATTAGGG + Intergenic
979649471 4:123114062-123114084 CAGGATGATCAACATCAGAGAGG - Intronic
980391128 4:132148420-132148442 GATGAGAATCAATGTCAGTATGG + Intergenic
982774496 4:159427919-159427941 CAGGACATGCAACAGCAGTATGG - Intergenic
985255623 4:188067549-188067571 CATGTGTATCCACATCAGTAGGG - Intergenic
989260979 5:39420095-39420117 CAGCAGCATCAACATCAGCTGGG - Intronic
991218763 5:64188048-64188070 AAGAAGATTCAATATCAGTAGGG + Intronic
992912295 5:81407927-81407949 CAGGAGAATGAGCATTAGCAGGG + Intergenic
994454114 5:99983627-99983649 CAGGGGAAACAAGATCAGTTAGG + Intergenic
994978707 5:106844331-106844353 CTGGAGAAATAACATCAGTATGG + Intergenic
995756913 5:115515291-115515313 CAGAAGAATAAACATGAGTGGGG - Intergenic
999131631 5:149288126-149288148 CTGGTGAATGAACATCAGTTGGG + Intronic
999154880 5:149450941-149450963 CAGAAGAATCAGCATCAGCGAGG - Intergenic
1000026811 5:157366186-157366208 AAGGAGAATCAGCATCATTAGGG - Intronic
1000135293 5:158342534-158342556 CAGGAGTATAAACATCAGGAGGG + Intergenic
1003215491 6:4105660-4105682 GAGTTGAATCAAGATCAGTAGGG + Intronic
1003389295 6:5699408-5699430 CAGCAGTATCAACATCAGCTGGG + Intronic
1003588290 6:7414071-7414093 CACCAGAATGAACATCAGGAGGG - Intronic
1004252178 6:14031861-14031883 CAGGAGAGTCAACACCAGAGTGG + Intergenic
1004442362 6:15666098-15666120 TTTGAGAACCAACATCAGTATGG + Intergenic
1004525093 6:16399993-16400015 CAGCAGCATCAGCATCACTAGGG + Intronic
1005003878 6:21269275-21269297 CAGGACAGTAAAGATCAGTAGGG - Intergenic
1006677648 6:35775964-35775986 ACAGAGAATCAACATCAGGAAGG + Intergenic
1007064525 6:38976548-38976570 CAGAAGCATCAACATCACTTGGG + Intronic
1008487262 6:52049892-52049914 CAGCAGAATCAGCATCACCAAGG + Intronic
1008864685 6:56195252-56195274 CAGCAGAATCAGCATCACTTGGG - Intronic
1011233152 6:85186758-85186780 CAGTAGCATAAAAATCAGTAAGG + Intergenic
1011406554 6:87021604-87021626 CAGGAGTATCAGCATCAATATGG + Intergenic
1011882140 6:92042215-92042237 CAGCAGCATCAACATCAGCTGGG + Intergenic
1012797435 6:103780417-103780439 CAGCAGCATCAGCATCAGTTAGG - Intergenic
1014961987 6:127697389-127697411 CAGAAGAAGCAATATCAGTGAGG - Intergenic
1015646445 6:135394790-135394812 CAAGAGATTCTACATCAGTTTGG - Exonic
1016714220 6:147204535-147204557 GAGGAAATTCAACATCAGGAAGG + Exonic
1018757251 6:166860912-166860934 CAGAAGAATCAGTAACAGTAGGG + Intronic
1020244448 7:6419931-6419953 CAGGAGATTCAAGACCAGTCTGG + Intronic
1022334136 7:29406668-29406690 CAGCAGCATCAACATCAGCTGGG + Intronic
1022813990 7:33896396-33896418 CAGGAGCATCTACATCACTGGGG - Intergenic
1027779473 7:82504378-82504400 GAGCAGAATCAACAGCAGAATGG + Intergenic
1030593856 7:111512271-111512293 CAGGAAAAACCACATTAGTATGG + Intronic
1030808245 7:113943775-113943797 CATTAGATTCAAAATCAGTATGG - Intronic
1030928700 7:115494113-115494135 CAGCAGAATCAAACTCAGTAGGG - Intergenic
1031744395 7:125475244-125475266 CAGAACAGTCAACATCAGTTTGG + Intergenic
1033486561 7:141795340-141795362 CTGGAGAGTCAACCTCAGAATGG + Intergenic
1037475753 8:19255795-19255817 CAGCAGACAGAACATCAGTAAGG + Intergenic
1037524642 8:19712891-19712913 CAGGAGCCTTAACATCAGTCAGG - Intronic
1042331950 8:67589804-67589826 CAGGAGAATCATCTTCTTTAGGG - Intronic
1045964628 8:108010665-108010687 CAGAAGAGTGAAGATCAGTAAGG + Intronic
1048248726 8:132839171-132839193 CAGGAGAAGAAACACCATTAAGG - Intronic
1048636328 8:136299892-136299914 CAGAATAATAAAAATCAGTATGG - Intergenic
1048667597 8:136680372-136680394 CAGAAAAATCAACATGTGTAGGG - Intergenic
1049952045 9:654897-654919 CAGCAGCATCACCATCACTAGGG - Intronic
1051278463 9:15418991-15419013 CAGGAGGATCAAAAGTAGTAGGG + Intergenic
1052149774 9:25101659-25101681 CAGGTGAGTCAACATCAGAGAGG - Intergenic
1053511676 9:38693198-38693220 CATGGGAATGAACATCAGGAAGG - Intergenic
1058428366 9:104896044-104896066 AAGAAGAATAAACATCAGAAAGG + Intronic
1058437684 9:104978149-104978171 AAGGAGAATCAATAACAGAAGGG - Intergenic
1058784818 9:108376795-108376817 CATGAGCATAAACTTCAGTATGG - Intergenic
1059610709 9:115889830-115889852 CAGGAGAATTTACATCAACAAGG + Intergenic
1186932197 X:14405964-14405986 CAGGAGAGTCAACATCCGAGGGG + Intergenic
1191598254 X:62972169-62972191 GAGAAGAATCAATATCAATATGG + Intergenic
1193375033 X:80749574-80749596 CAGGAGACTCATCATCTCTAAGG - Intronic
1194173105 X:90613274-90613296 CAGCAGAATCAAAATCTTTAGGG + Intergenic
1194189179 X:90813553-90813575 CTGGAGAATAAAAATCAGCATGG + Intergenic
1194739458 X:97555601-97555623 CAGGGAAATCAATGTCAGTATGG + Intronic
1194790610 X:98144802-98144824 CAGCAGCATCAACATCACTTGGG + Intergenic
1194994087 X:100574232-100574254 CAGAAAAATCAACAGCATTAGGG - Intergenic
1195598739 X:106722434-106722456 CAGGAGCATCAGCATCATCAGGG - Intronic
1195762004 X:108256646-108256668 CAGGAGCATCAGCATCATTTGGG + Intronic
1196360997 X:114858012-114858034 CAGGAGAAACAACATATATAAGG - Intronic
1196848797 X:119918032-119918054 GAGGAGAAGCAAGATCAGAATGG - Intronic
1198620141 X:138498993-138499015 CAAGAGAATCCACACCACTAGGG - Intergenic
1198793909 X:140375531-140375553 CAGCAGTATCAACACCAGTTAGG + Intergenic
1199674799 X:150179086-150179108 GAAGATAATCAACATCTGTAAGG - Intergenic
1200519328 Y:4190993-4191015 CAGCAGAATCAAAATCTTTAGGG + Intergenic
1200535759 Y:4395446-4395468 CTGGAGAATAAAAATCAGCATGG + Intergenic