ID: 1124009024

View in Genome Browser
Species Human (GRCh38)
Location 15:25820700-25820722
Sequence GAAAATTCAAAAATGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 568}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124009024 Original CRISPR GAAAATTCAAAAATGCTGCT TGG Intronic
900220569 1:1507084-1507106 GAAAATCCTAGAATCCTGCTGGG - Intergenic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900632146 1:3642744-3642766 AAAAAAAAAAAAATGCTGCTGGG + Intronic
900757660 1:4448112-4448134 GGAAATTCAGAAACACTGCTTGG - Intergenic
901089444 1:6631607-6631629 AAAAATACAAAAATTCGGCTGGG + Intronic
901108031 1:6772860-6772882 AAAAATTCTAAAATCTTGCTGGG + Intergenic
901169021 1:7241714-7241736 TAAATTTAAAAAATGGTGCTGGG + Intronic
902166860 1:14579462-14579484 AAAAATACAAAAAAGCAGCTGGG + Intergenic
903389599 1:22954534-22954556 GAAAATTCACAAATTCTCCTAGG + Intronic
903609875 1:24602877-24602899 GAAAATACAAAAAATCAGCTGGG + Intronic
905079017 1:35300340-35300362 GAGAATTCTTAAATGCAGCTGGG - Intronic
905710878 1:40101747-40101769 GAAAATTGAAAATGGCTACTGGG + Intergenic
905818692 1:40972459-40972481 GAATTTTGATAAATGCTGCTAGG + Intergenic
905903065 1:41594966-41594988 GACTATTCAATAATGCTGTTGGG - Intronic
907127234 1:52061799-52061821 AAAAATACAAAAATTCAGCTGGG - Intronic
907694011 1:56702376-56702398 GAAAAGATAAAAATGATGCTGGG - Intronic
908137326 1:61146580-61146602 GAAAATTCAGGAAGGCTCCTTGG - Intronic
908221957 1:62015948-62015970 AAAAATACAAAAATTCAGCTGGG - Intronic
908305591 1:62812409-62812431 TAAAATTCAAAACTGCTTCATGG + Intronic
908688935 1:66754966-66754988 GAAATAGCAAAAATGCTGCTAGG - Intronic
908695072 1:66830618-66830640 AAAAATTCAAAAAAGTAGCTGGG + Intronic
908853606 1:68397726-68397748 GAAAATTAAAAATTGCTTTTCGG - Intergenic
908858228 1:68453085-68453107 GAAAATTTTAAAAAGCTGCTGGG - Intergenic
909135189 1:71789853-71789875 GAAAATCCAAATATGCTACCTGG + Intronic
909484296 1:76156388-76156410 GAAATTTCAAAAATGTTTATAGG - Intronic
909628986 1:77751350-77751372 GTAAATGCAAAACTGCTTCTGGG + Intronic
910781056 1:90933692-90933714 GAAAATTCTAAAATGAAGGTGGG - Intronic
911556150 1:99347298-99347320 GGAACTTCACAAATGCTTCTCGG + Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912148498 1:106825030-106825052 GAAAATTCACAAATACTGAAAGG - Intergenic
912408106 1:109459162-109459184 AAAAATTTAAAAATTCTGCTCGG - Intergenic
912692117 1:111812330-111812352 GGAAATGCAAAAATGATGGTGGG + Intronic
913097143 1:115529232-115529254 GAAAACTCAAAATTGCCCCTGGG - Intergenic
913466401 1:119147636-119147658 GAGAATTAAAAAATGCTTCCAGG - Intergenic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
916023642 1:160815382-160815404 AAAAATTTAAAAATGCAGGTTGG - Intronic
916368097 1:164056722-164056744 GAAATTTAAAAAATGATGATAGG - Intergenic
916728563 1:167545642-167545664 GAAAATACAAAAAATCAGCTGGG + Intronic
916783684 1:168065441-168065463 TAAAATTAAAAATTGATGCTGGG - Intronic
918036298 1:180875570-180875592 GAAAAATGTAAAATGCAGCTAGG + Intronic
918072350 1:181142233-181142255 GAAAATCTAAAAATGCTTATGGG + Intergenic
918949964 1:191124529-191124551 TAAAAGTCAATAATCCTGCTGGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919378592 1:196825472-196825494 GAAAATCACAAAATGTTGCTGGG - Exonic
919874152 1:201849718-201849740 GGTAATTCAAAAAGGCAGCTGGG - Intronic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
921089130 1:211826202-211826224 GTAAATTCATACATGCTTCTTGG - Intronic
921128334 1:212197567-212197589 AAAAATACAAAAATTATGCTGGG + Intergenic
922904265 1:229162063-229162085 GAAAATTAAAAAACGTAGCTGGG - Intergenic
923217025 1:231857819-231857841 GTGCATTCAAGAATGCTGCTTGG + Intronic
923399138 1:233599440-233599462 GGAAATTGAATAATGCTGCCTGG + Intergenic
923832516 1:237573823-237573845 GAAAATAAAAAGATGCTGTTAGG + Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924519771 1:244795837-244795859 TAAAATACACTAATGCTGCTGGG + Intergenic
924611760 1:245579506-245579528 GAAAATTTAAAAAGGAGGCTTGG + Intronic
924641905 1:245841774-245841796 GAAAATTCTAAAATGCTGGAAGG - Intronic
1063656173 10:7991781-7991803 TAAAATTCAAAAAAGCTGCTAGG - Intronic
1063858851 10:10286739-10286761 GAAAAGCAAAAAATGTTGCTTGG + Intergenic
1064060970 10:12136923-12136945 AAAAATACAAAAATTCAGCTGGG - Intronic
1064190410 10:13200983-13201005 GAAAATCCAAAAATTTAGCTGGG + Intronic
1064537427 10:16372080-16372102 GAAAATTGTAAGATGCTACTGGG + Intergenic
1065962687 10:30746885-30746907 GAAAATACAAAAAACTTGCTGGG - Intergenic
1066039535 10:31533277-31533299 GAAAACTACAAAATGTTGCTGGG + Intergenic
1067778773 10:49182718-49182740 CAAAATTTAAAAATACTGATTGG + Intronic
1067907272 10:50306423-50306445 TAAAATTTAAAAATGCATCTTGG - Exonic
1068019020 10:51557216-51557238 GCAGATTAAGAAATGCTGCTGGG + Intronic
1068186216 10:53589924-53589946 AAAAATACAAAAAATCTGCTGGG - Intergenic
1068261073 10:54582751-54582773 GAAAATTAAAAAATATAGCTGGG + Intronic
1069243534 10:66171868-66171890 AAAAAATCATCAATGCTGCTGGG + Intronic
1069609613 10:69764046-69764068 GAAAGTTCCAAGATTCTGCTGGG + Intergenic
1069938348 10:71935431-71935453 TAAAAATCAAAACTTCTGCTTGG - Intergenic
1071767570 10:88685751-88685773 TAAAATAAAAAAATGCTTCTTGG + Intergenic
1073904310 10:108259809-108259831 TAAAATTCAATAGTGTTGCTTGG + Intergenic
1074491579 10:113943860-113943882 GAAAATTTGAACATGCTGGTGGG + Intergenic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1074725927 10:116309793-116309815 GAAAAATCAGTAATACTGCTAGG + Intergenic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1077234688 11:1474537-1474559 GTCTGTTCAAAAATGCTGCTGGG - Intronic
1077804881 11:5580470-5580492 GAAAATACAAAAAATCAGCTGGG - Intronic
1078212775 11:9284305-9284327 AAAAATTCAAAAATTTTGCCTGG - Intronic
1078229040 11:9421781-9421803 AAAAATTCAAAAATGTAGCCGGG + Intronic
1079222021 11:18571427-18571449 TAAAATGCAAGAATACTGCTGGG - Intronic
1080214470 11:29825484-29825506 GAAAATTCATCAATTCTTCTTGG + Intergenic
1080250354 11:30226772-30226794 GAAATTTAAAAAATTTTGCTGGG + Intergenic
1080313735 11:30924910-30924932 GAAAATACAAAAAATCAGCTAGG + Intronic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1083028550 11:59571207-59571229 GCAATGTCAAAAATGCTGCATGG - Intergenic
1083697229 11:64450855-64450877 GAAGATTCTAATATGTTGCTTGG + Exonic
1083793496 11:65001110-65001132 AAAAATACAAAAATTTTGCTGGG - Intergenic
1083937659 11:65878651-65878673 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1085129422 11:74025436-74025458 AAAAATACAAAAATGCTCCTGGG + Intronic
1085178623 11:74512333-74512355 GAGAATTCAAAATAGCTGTTTGG + Intronic
1087876405 11:103363427-103363449 GCAATTTCAAAATTGCTGTTAGG + Intronic
1087991352 11:104747717-104747739 AAAAATTTAAACATGCTCCTAGG - Intergenic
1088060659 11:105645294-105645316 CAAAATTCAGATATGCTCCTTGG + Intronic
1088393520 11:109342128-109342150 GAAAATTGATACATGGTGCTGGG + Intergenic
1088891151 11:114045377-114045399 GAACATTCCAAAAAGATGCTGGG + Intergenic
1089935219 11:122357627-122357649 AAAAATTCAAAAATGTAGCTGGG + Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090349279 11:126097199-126097221 GAAAATACAAAAATTAGGCTGGG - Intergenic
1090494952 11:127202536-127202558 GAAAATTAGAAAATGTTGATTGG + Intergenic
1091041055 11:132282015-132282037 GATATTTCAGAAATGCTGCCAGG + Intronic
1091755959 12:3051797-3051819 GAAAATACAAAAAATTTGCTGGG - Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093432839 12:19103840-19103862 GAATATTCAAAAAATCTTCTTGG + Intergenic
1093601861 12:21036315-21036337 TAAAATTCAACAATGCTTCATGG - Intronic
1093956974 12:25231440-25231462 CAAAATCCAAAAATACTTCTAGG + Intronic
1094126252 12:27025185-27025207 TAAAAATGAAAAATGCTGCTTGG + Intronic
1094539267 12:31349433-31349455 GAAGATTGAAAAATGTTGCCGGG - Intergenic
1094701109 12:32871757-32871779 AAAAATTTAAAAATGTGGCTGGG - Intronic
1095221157 12:39617765-39617787 AAAAATTAAATAATTCTGCTTGG + Intronic
1096531943 12:52248072-52248094 GAAAAATCAATGATCCTGCTTGG + Intronic
1097256139 12:57675919-57675941 GAAAATACAAAAAATCAGCTGGG - Intergenic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098766691 12:74499143-74499165 AAAATTTTAAAAAAGCTGCTGGG + Intergenic
1099725283 12:86418844-86418866 GAAAATTGAAAAAAGTTGATTGG + Intronic
1099778134 12:87160802-87160824 GAAAATTTAAATATATTGCTTGG - Intergenic
1100180960 12:92085944-92085966 GAAAATATAAACAAGCTGCTTGG + Intronic
1100938888 12:99703004-99703026 TAAATTGCAAAAATGGTGCTGGG - Intronic
1101482567 12:105113872-105113894 GAAAATTCAAAAATGATGAAAGG + Intronic
1101649885 12:106667745-106667767 GAAAAATCAACAATTCTTCTTGG - Intronic
1101697750 12:107142389-107142411 GAAAATTTAGAAATGATGCCTGG - Intergenic
1101917867 12:108910255-108910277 GAAAGTTAAAAACTCCTGCTGGG - Intergenic
1102017079 12:109655246-109655268 AAAAATTAAAAAATTCAGCTGGG - Intergenic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1103066666 12:117904411-117904433 GAGAACTCAAAAGTGCAGCTTGG + Intronic
1103384396 12:120520628-120520650 AAAAATACAAAAATTCAGCTGGG - Intronic
1103616240 12:122154529-122154551 GAAAACTCAGAAATGCTGCCAGG - Intergenic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104101170 12:125612011-125612033 GAAAATTCAACAATACTAGTGGG - Intronic
1106641868 13:31593066-31593088 AAAAAGTAAAAAATGCAGCTGGG - Intergenic
1106874979 13:34061691-34061713 GAAGATCCAAAAAAGCTGTTAGG - Intergenic
1107364352 13:39654599-39654621 GAAAACTTTAAAATGCTACTGGG - Intergenic
1107799004 13:44086563-44086585 GAAAATTAAAAAGTGCTGGAAGG + Intergenic
1108079594 13:46721070-46721092 CAAAATTAAAAAATGATGCCAGG + Intronic
1108429421 13:50339241-50339263 TAAACTTCAAAACTGCTGCCTGG + Intronic
1108961723 13:56241730-56241752 AAAAACTAAAAATTGCTGCTGGG - Intergenic
1109193463 13:59352725-59352747 GAAAATTGAAAAATGCCACAGGG - Intergenic
1109498110 13:63201364-63201386 GAAAATTCAAAAATAATAGTTGG + Intergenic
1110009127 13:70309287-70309309 GAGTATTCAATTATGCTGCTTGG - Intergenic
1110167496 13:72460827-72460849 GACAATTTAAAGGTGCTGCTAGG + Intergenic
1110301333 13:73931150-73931172 GAAAATTAAAATATGTGGCTAGG - Intronic
1110577180 13:77071405-77071427 TAAGAATCAAAAATGATGCTTGG + Intronic
1111946837 13:94674801-94674823 GTATTTTCAAAAATGCTGATAGG - Intergenic
1111963481 13:94836339-94836361 GAAGCTTCAAAAATTCTACTTGG + Intergenic
1112053518 13:95669192-95669214 GAGAATTCAAAATAGCTGTTTGG - Intergenic
1113515623 13:110895067-110895089 GAAAATTCAAAAACTCTTCAAGG + Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114348336 14:21821442-21821464 GAAAATTCAACAATTCATCTTGG - Intergenic
1114536015 14:23423152-23423174 GGAATTTCAAAAATTCTACTTGG + Intronic
1114590781 14:23862798-23862820 GAAAGTTCAGCAAGGCTGCTAGG - Intergenic
1115016531 14:28622083-28622105 GAAAATTTGAAAATGTTGCATGG - Intergenic
1115060262 14:29179560-29179582 AAAAATTTAAATATGCTTCTTGG - Intergenic
1115224700 14:31090376-31090398 GAAAATTCAGAAAGGCTCTTAGG + Intronic
1115705723 14:35995891-35995913 GAAAAGTTAAAGATTCTGCTAGG + Intergenic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116652486 14:47611116-47611138 GCCTATTCAAAAATGGTGCTGGG + Intronic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117676401 14:58159136-58159158 GAAAATACAAAAAATTTGCTGGG - Intronic
1117960934 14:61160690-61160712 TATATTTGAAAAATGCTGCTGGG - Intergenic
1118085396 14:62409575-62409597 GAACATTCATAAATGCTTTTAGG + Intergenic
1118259953 14:64237119-64237141 GAAAATACAAAAAATTTGCTGGG - Intronic
1119241125 14:73060394-73060416 GAAAATTCCAAATTCCTGTTAGG - Intronic
1120047455 14:79823980-79824002 GAAAGTTTAAAATTTCTGCTTGG + Intronic
1120613283 14:86669609-86669631 TAAAATTCAAAAATGTATCTAGG + Intergenic
1120853865 14:89196062-89196084 GAAAATTGAAATAGGCTGCTGGG - Intronic
1122103567 14:99433596-99433618 GAAAATACAAAAAATCAGCTGGG - Intronic
1122541693 14:102501379-102501401 CAAAATACAGAAATGCTGCTGGG + Exonic
1123428127 15:20189677-20189699 GAAACCTCAAAATTGCTGATTGG + Intergenic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1124387274 15:29220436-29220458 GAAAAATCACAAATACTGATCGG - Intronic
1125012973 15:34900051-34900073 AAAAATTCAAAAAAGTAGCTGGG - Intronic
1125116012 15:36092543-36092565 CTACATTCAAATATGCTGCTAGG - Intergenic
1125355637 15:38814847-38814869 GAAGTCTCAAAAATGCTACTAGG - Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126497459 15:49307801-49307823 AAATATTCACAAATGCTTCTTGG + Intronic
1126504125 15:49383595-49383617 AAAAATTCAAAAGTCCTGCTAGG + Intronic
1126581241 15:50244461-50244483 AAAAATTAAAAAATGTAGCTGGG - Intronic
1126599052 15:50410707-50410729 GAGCATTTAAAAATGCTTCTTGG + Intergenic
1127894958 15:63289841-63289863 AAAAATTAAAAAATTCAGCTGGG + Intronic
1128791158 15:70434899-70434921 GAAAATCCAAACCTCCTGCTAGG + Intergenic
1129380542 15:75162624-75162646 AAAAATGCAAAAAATCTGCTGGG + Intergenic
1130343977 15:83024758-83024780 AAAAATTCAAAAATTCAGCATGG - Intronic
1130889710 15:88123336-88123358 GAAAATTCAAAACTGAGACTGGG + Intronic
1132136409 15:99344636-99344658 GATAATTTAAAAATGCTATTAGG - Intronic
1132151970 15:99468282-99468304 CATAATTCAAAAATGAGGCTGGG + Intergenic
1132740043 16:1407533-1407555 AAAAATACAAAAATTCAGCTGGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133289118 16:4706530-4706552 GAAAATACAAAATTGTGGCTGGG - Intronic
1135410111 16:22227382-22227404 GAAAATACAAAACTTTTGCTGGG - Intronic
1135540415 16:23325560-23325582 AAAAATTCAAAAAAGAGGCTGGG - Intronic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136344338 16:29665213-29665235 AAAAATACAAAAAAGCAGCTGGG - Exonic
1136856189 16:33660073-33660095 GAAACCTCAAAATTGCTGATTGG - Intergenic
1138378094 16:56580745-56580767 GAAAAGATCAAAATGCTGCTAGG - Intergenic
1138378095 16:56580819-56580841 GAAAAGATCAAAATGCTGCTAGG - Intergenic
1138995048 16:62440542-62440564 AAAAATTAACAAATGCTGGTAGG + Intergenic
1139540676 16:67613613-67613635 GAAAATACAAAAAATCAGCTGGG + Intronic
1139679005 16:68545346-68545368 GAAAGTATAAAATTGCTGCTTGG - Intronic
1139706740 16:68746262-68746284 AAAAATTCAAAAATTCAGCTGGG + Intronic
1140769731 16:78192333-78192355 AAAAATTCAAAAATTAGGCTTGG + Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141115492 16:81305110-81305132 GATCATTCAAACATGCTGCGTGG - Intergenic
1141549854 16:84798861-84798883 GAAAAAAAAAAAAAGCTGCTGGG - Intergenic
1142043339 16:87909367-87909389 GAAAACCCAAAAAGGCTACTGGG + Intronic
1203117775 16_KI270728v1_random:1508552-1508574 GAAACCTCAAAATTGCTGATTGG - Intergenic
1142477910 17:200570-200592 GAAGAATCACAAATGCTGCCTGG - Intergenic
1142586286 17:976346-976368 GAAAATTGAAAAATTATGGTGGG - Intronic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143686821 17:8524004-8524026 GAAAATTCCAGTCTGCTGCTAGG + Intronic
1143737932 17:8926920-8926942 ATAAATTAAAAAATGGTGCTGGG + Intronic
1144636795 17:16915185-16915207 AAAAATACAAAAAAGCAGCTGGG + Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1144826852 17:18110018-18110040 GGAGAGTCAAAAAGGCTGCTCGG - Intronic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1145389679 17:22445797-22445819 GAGAACTCAAAACAGCTGCTGGG + Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1146487264 17:33253430-33253452 GAAAATGAAAAATTACTGCTAGG + Intronic
1147272342 17:39283569-39283591 CAAAAATCCAAAATGCAGCTGGG - Intronic
1147630602 17:41928548-41928570 GAAAAAAAAAAAAGGCTGCTGGG + Intronic
1149487468 17:57054126-57054148 TTATATGCAAAAATGCTGCTGGG - Intergenic
1149951726 17:60995455-60995477 TAAAATACAAAAATTCGGCTGGG - Intronic
1150526459 17:65928307-65928329 GAACCTTCAACACTGCTGCTGGG + Intronic
1150895394 17:69204347-69204369 GAAAATTAAAATGTGTTGCTGGG + Intronic
1151338887 17:73457118-73457140 TAGAATTAAAAAATGCTGATGGG + Intronic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151738491 17:75961999-75962021 GCAATTTCAATAATGCTTCTAGG + Intronic
1152432427 17:80256524-80256546 CAAAATTTAAAAATGTGGCTGGG - Intergenic
1153334654 18:3910607-3910629 GAAAACTGAAAATGGCTGCTTGG + Intronic
1153524809 18:5984907-5984929 GGAAAATAAAAACTGCTGCTTGG + Intronic
1153848737 18:9072991-9073013 GAAAATACAAAAATTAGGCTGGG + Intergenic
1154228886 18:12535613-12535635 GAAAATAAAATAATGGTGCTTGG + Intronic
1155185121 18:23380628-23380650 GAAATGTCAAACATGTTGCTAGG - Intronic
1155505889 18:26532422-26532444 AAAAATTTAAAAATGTAGCTGGG - Intronic
1155659062 18:28226327-28226349 AAAAATTAATAAATGGTGCTGGG - Intergenic
1155767560 18:29653903-29653925 GAGAATTCAAAACAGCTGTTTGG + Intergenic
1156563297 18:38154255-38154277 GAAAATTCAAAAATTTTATTTGG + Intergenic
1157923141 18:51734236-51734258 AAATTTTCAATAATGCTGCTAGG + Intergenic
1158199339 18:54922690-54922712 AAAAATGCAAAAATTATGCTGGG + Intronic
1158660363 18:59381813-59381835 GAATCTACTAAAATGCTGCTTGG + Intergenic
1158694015 18:59687104-59687126 GAAAATTCCAAAATGAAGCAAGG + Intronic
1159010428 18:63054130-63054152 GAAAATCCAAGAATGTAGCTTGG + Intergenic
1159147755 18:64476615-64476637 GCAAATACAAAAATAGTGCTGGG + Intergenic
1159862694 18:73667970-73667992 AAAAATACAAAAATGCTGCCTGG + Intergenic
1160120729 18:76128594-76128616 GAAGATCCAAAATTCCTGCTTGG + Intergenic
1161732784 19:5972233-5972255 GGAAAATCAAAACTGCTGCCTGG - Intronic
1162012363 19:7825327-7825349 AAAAATACAAAAATTTTGCTGGG + Intergenic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1162568336 19:11456658-11456680 AAAAATTAAAAAATGTGGCTGGG - Intronic
1162611917 19:11762329-11762351 GAAACTTTAAAAACTCTGCTAGG - Intergenic
1162838107 19:13334871-13334893 GAAAAATAAAAAATGTAGCTGGG + Intronic
1162882097 19:13667334-13667356 AAAAAAAAAAAAATGCTGCTGGG + Intergenic
1163016936 19:14462152-14462174 AAAAATACAAAAATTCGGCTGGG + Intronic
1163067325 19:14807733-14807755 AAAAATACAAAAATTCAGCTGGG + Intronic
1163671867 19:18634100-18634122 AAAAATACAAAAATTATGCTGGG + Intergenic
1163955894 19:20639439-20639461 TTAAATTCAAAAATACTGATTGG + Intronic
1166363325 19:42265507-42265529 AAAAATACAAAAATTCGGCTGGG - Intergenic
1167694199 19:51004537-51004559 GAAAATACAAAAAATCAGCTGGG + Intronic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168223683 19:54979335-54979357 GAAAAAACAAAAATGCTACCAGG - Intronic
926454593 2:13050081-13050103 AAATATTTAATAATGCTGCTGGG + Intergenic
928151059 2:28829646-28829668 GAAAATACAAAAATTAGGCTGGG + Intronic
928510499 2:31998637-31998659 AAAAATACAAAAATTCAGCTGGG + Intronic
928568460 2:32578633-32578655 AAAAATACAAAAATTCAGCTGGG + Intronic
928660088 2:33493088-33493110 GAAAATTCAAAGAGGCCCCTTGG - Intronic
928842627 2:35628921-35628943 GTAAATTCAAAAATGATGGCTGG + Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
929904152 2:46031436-46031458 GAAAATTAATAAATGCTACAGGG - Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933495157 2:83041072-83041094 TAAAATACAAAAAATCTGCTGGG + Intergenic
933887748 2:86735700-86735722 AAAAATACAAAAATGTGGCTGGG - Intronic
933922429 2:87061012-87061034 AAAAATACAAAAATGTGGCTGGG + Intergenic
934750509 2:96790822-96790844 AAAAATACAAAAATCCAGCTGGG + Intronic
935018732 2:99210498-99210520 CAGAATTCAAAATAGCTGCTTGG - Intronic
935186431 2:100738051-100738073 GAATCTGCAAAAAAGCTGCTGGG + Intergenic
936343227 2:111655971-111655993 GAAAATCCAAGAATGCAACTGGG + Intergenic
936473445 2:112819082-112819104 GAATATTAAGAAATGTTGCTTGG + Intergenic
937595333 2:123665399-123665421 AAAAATTCAAAAATTTAGCTGGG + Intergenic
938300235 2:130205613-130205635 AAAAATGTAAAAATGCGGCTGGG - Intergenic
938456487 2:131468882-131468904 AAAAATGTAAAAATGCGGCTGGG + Intronic
938793360 2:134696736-134696758 GAAATTCCAACAAAGCTGCTGGG - Intronic
939339891 2:140881735-140881757 GGAAAGTCAAAAATGCTTCTGGG - Intronic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
940247603 2:151636482-151636504 GAAGACTCAAAAATGAGGCTAGG + Intronic
940491907 2:154372774-154372796 GAAAACTCAAATATGCTGAAAGG - Intronic
940797079 2:158091187-158091209 GCAAATACAAAACTGCTGCCTGG + Intronic
940829369 2:158450964-158450986 GAAAAATGAACAAAGCTGCTGGG - Intronic
940987111 2:160061612-160061634 AAAAATACAAAAATTTTGCTGGG + Intronic
941011070 2:160299812-160299834 GGAAATTGAGAACTGCTGCTAGG + Intronic
941368211 2:164632942-164632964 TAAAATTAACAAATGCTCCTGGG + Intergenic
941555146 2:166969474-166969496 AATAATTCCAAAATCCTGCTGGG + Intronic
941698300 2:168576865-168576887 GAGAATTCAAGAATGACGCTTGG + Intronic
941707466 2:168675132-168675154 TAAAATACAAAAAATCTGCTAGG - Intronic
941778114 2:169414642-169414664 GAAATTTTACAAATCCTGCTCGG + Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
942029616 2:171945963-171945985 AAAAATTCAAAAATTAGGCTGGG - Intronic
942360092 2:175163648-175163670 AAAAAATGAAAAATGATGCTGGG + Intronic
942989479 2:182182243-182182265 GAAGAATCAAAAATGATGCCAGG - Intronic
943171058 2:184400974-184400996 TAAAATTTAAAAATACTACTTGG + Intergenic
943231928 2:185264846-185264868 GAGAATTCAAAAATTGTGGTTGG - Intergenic
943241844 2:185394842-185394864 GAAAATACAAACAAGCTTCTAGG - Intergenic
943294527 2:186119817-186119839 AAAAATACAAAACTGCTACTCGG + Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944276440 2:197843828-197843850 GACAAGTCAAAAATGTTCCTTGG - Intronic
944280602 2:197892202-197892224 TAAAACTGAAAAATGCGGCTGGG + Intronic
944561914 2:200948206-200948228 GAAAATTTAAAAATTAGGCTGGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945246740 2:207724642-207724664 GACAATACAAAAATACTCCTGGG - Intronic
945338634 2:208622723-208622745 AAAAATAAAAAAATCCTGCTAGG + Intronic
945706066 2:213233445-213233467 GAAAATTCAAAAACACTCATGGG - Intergenic
946200078 2:218066086-218066108 GAAATGTCCAAAGTGCTGCTAGG + Intronic
946554367 2:220838331-220838353 GAAAACTCTAAAATGCTTGTGGG + Intergenic
946796366 2:223358517-223358539 TAAAATTCAAAACTGAAGCTTGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
948410056 2:237752406-237752428 AAAAAAGAAAAAATGCTGCTGGG + Intronic
1169070024 20:2720255-2720277 AAAAATACAAAAATTCAGCTGGG - Intronic
1169231364 20:3890734-3890756 GAAGATTCAAAAAAGCAGTTGGG - Intronic
1169432185 20:5546996-5547018 TAAAATTTCAAAATGCTGCAGGG - Exonic
1169937031 20:10894686-10894708 GAAAATTCTAAAATACTCTTGGG - Intergenic
1170144524 20:13158341-13158363 TTAAATTCAAAAATGCTCCAGGG + Intronic
1170249744 20:14267380-14267402 GCAAATTCAAGAATGTTGGTAGG + Intronic
1170406250 20:16041090-16041112 TTAAATTCAAAAATACTCCTGGG - Intronic
1170579681 20:17688652-17688674 TAACATTTAAAAATCCTGCTGGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1172159860 20:32859886-32859908 GAAAAAACAAAAATGCTGCAAGG - Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1175837341 20:62004620-62004642 GAAAATTCAGAAAGGGAGCTGGG - Intronic
1176732861 21:10518111-10518133 AAAAATACAAAAATTCAGCTGGG + Intergenic
1177071354 21:16512673-16512695 AAAAATCCAAAAATGTTGGTTGG - Intergenic
1177147331 21:17420772-17420794 AAAATTTAAAATATGCTGCTGGG - Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1177914452 21:27071211-27071233 GAAAATTTAATAATCGTGCTTGG + Intergenic
1178236855 21:30853118-30853140 TAAAATGTAAAAATGGTGCTGGG + Intergenic
1178988572 21:37331771-37331793 CAAAATTTAAAAATTCTTCTGGG - Intergenic
1179264183 21:39788028-39788050 GAAAACTTAATAATGCTCCTTGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181182208 22:21076244-21076266 GAAAATTTAAAATTGTGGCTGGG - Intergenic
1181185944 22:21103792-21103814 GAAGATTTAAAAATGCAGCAAGG - Intergenic
1182628567 22:31666669-31666691 TAAAATTAAAAAATGAGGCTGGG - Intergenic
1182794030 22:32977343-32977365 GAAAATTAAAACATGCCCCTGGG + Intronic
1182982817 22:34687564-34687586 GTAAATAAATAAATGCTGCTAGG + Intergenic
1183161981 22:36120506-36120528 AAAAATTAAAAAATTCAGCTGGG + Intergenic
1183888885 22:40908622-40908644 GAAAAGTGAAAAAGGATGCTAGG - Intronic
1183911208 22:41080650-41080672 AAAAATACAAAAATTTTGCTGGG + Intergenic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1184167144 22:42736427-42736449 GAAAATTTAAAAATGCATTTTGG - Intergenic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1185262303 22:49874532-49874554 AAAAATACAAAAATGGTGGTGGG - Intronic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
949655682 3:6216127-6216149 GAAACTTCAAACATGCTGATTGG + Intergenic
951975590 3:28504034-28504056 AAAAATTCAAAAATTATGCCAGG + Intronic
952634565 3:35511953-35511975 GAAAATACAATTAAGCTGCTGGG - Intergenic
952666705 3:35915156-35915178 GAATGTACAAAAATGCTCCTGGG - Intergenic
952872580 3:37914111-37914133 GAAAATTCTAAAATGTTATTTGG - Intronic
953038222 3:39231833-39231855 GAAAATCCAAAAACGCTAATGGG - Intergenic
953085844 3:39666152-39666174 GAAAATTCATAAATGGGGATTGG + Intergenic
953759566 3:45675955-45675977 AAAAAGTAAAAAATCCTGCTGGG + Intronic
953813528 3:46134296-46134318 GGAAACTCAAAAGTGTTGCTGGG - Intergenic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
956670120 3:71681186-71681208 GAAAATGTAAAAATGATACTTGG - Exonic
956684672 3:71814070-71814092 CAAAATTCCAAATTGCTTCTTGG + Intergenic
956727913 3:72171761-72171783 AAAAAAAAAAAAATGCTGCTTGG + Intergenic
957748243 3:84374186-84374208 CTAATTTCAAAAATGCGGCTGGG + Intergenic
957820620 3:85369471-85369493 GAAAATACAAAATTTCGGCTGGG + Intronic
959265190 3:104128585-104128607 GAAAAATCAACAATTCTTCTTGG + Intergenic
959283813 3:104381321-104381343 GAAAATTCAGATATGTTTCTTGG - Intergenic
959326440 3:104943391-104943413 GATAATCTAAAAATGCTGCTGGG - Intergenic
959611662 3:108301783-108301805 GAAAAGTAAAGCATGCTGCTTGG - Intronic
960039442 3:113134665-113134687 GAAGATTCAAAAATGTGACTTGG - Intergenic
960238178 3:115309341-115309363 GAATAATCAAATATGCTGATTGG + Intergenic
960240319 3:115333279-115333301 AGAAATTTAAAAATGCTCCTGGG - Intergenic
960451433 3:117813803-117813825 TAAAATTTAAAAATGCTGGTTGG + Intergenic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
960976853 3:123184202-123184224 GAAAATACAAAAATTCGGCTGGG + Intronic
962380599 3:134895551-134895573 AAAAATTAAAATATGGTGCTAGG + Intronic
963082757 3:141409811-141409833 GAAAGTTTAAAACTGCTCCTTGG + Intronic
963386946 3:144609399-144609421 AATAATTCAAATATTCTGCTAGG - Intergenic
963391534 3:144670864-144670886 GAAAACATGAAAATGCTGCTGGG - Intergenic
963859102 3:150288660-150288682 TGAATTTCAACAATGCTGCTTGG + Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964437422 3:156669116-156669138 GAAGATTAGAAAATGCTCCTAGG - Intergenic
966300342 3:178471981-178472003 CAAAATTTAATCATGCTGCTGGG + Intronic
966350066 3:179024055-179024077 GAATATTCAAATATGAGGCTTGG + Exonic
966386445 3:179404142-179404164 GAAAATACAAAAAAGCTGCATGG + Intronic
966460606 3:180171911-180171933 AAGATTTCAAAAATGCTGATTGG - Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
968033187 3:195521152-195521174 GAAAATACAAAAAATTTGCTGGG + Intronic
968134812 3:196213628-196213650 GAAAAATCAAAAAAGAGGCTGGG - Intronic
968822285 4:2863661-2863683 GTAAAATCAAAAATGCTGTCTGG - Intronic
969267674 4:6075500-6075522 GAAAAAGAAAAAATGCTGGTGGG + Intronic
970837676 4:20430334-20430356 GGATATTCTAAGATGCTGCTGGG + Intronic
971317365 4:25578731-25578753 GAAGATACCAAAATCCTGCTCGG + Intergenic
971428173 4:26536337-26536359 CCAAATTCAACAATCCTGCTTGG + Intergenic
971702645 4:29998619-29998641 GAAAATTCAGTGATGCTGCAGGG - Intergenic
971992499 4:33917554-33917576 GACAATTCCAAAATGCCGCAAGG - Intergenic
972012127 4:34197193-34197215 GAAAATTCAGAAAGACTGTTTGG + Intergenic
972103807 4:35457213-35457235 GATAATTCAAAACAGCTGTTTGG - Intergenic
972863154 4:43196792-43196814 GAAAACTCAGAAATGCAGATAGG + Intergenic
972920351 4:43932011-43932033 AAACATTCAAAAATGTTGTTAGG - Intergenic
973163642 4:47050482-47050504 GAAATTTCCAAAATGCTTCTTGG - Intronic
973285520 4:48411507-48411529 GAAGAGTTCAAAATGCTGCTAGG - Intronic
973887014 4:55333273-55333295 GAAATTTTAAAAATATTGCTAGG + Intergenic
974227499 4:59065718-59065740 CAAAAAACAAAAATGCTGTTTGG - Intergenic
974361409 4:60885398-60885420 AAAAATACAAAAATACTGATGGG - Intergenic
974565085 4:63570907-63570929 GAAATTTAATAAATGGTGCTGGG - Intergenic
974915179 4:68170877-68170899 AACAATTCAAAAATACTACTAGG - Intergenic
975862122 4:78688798-78688820 GAAAATTCAAACATCCTTCTTGG + Intergenic
976670239 4:87644272-87644294 GAAAATTCAAAAAAGTGGCTGGG - Intergenic
976728343 4:88238854-88238876 GATAATTCAAAATAGCTGTTTGG - Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
979356810 4:119714755-119714777 TACAATTCAAAAATGCTGATAGG + Intergenic
979617896 4:122765233-122765255 GCAAATTTAAAACTGCTGTTTGG - Intergenic
979949309 4:126873178-126873200 AAAAATACAAAAATTTTGCTGGG - Intergenic
980262900 4:130477280-130477302 GAAAACTCAAAATTACTCCTTGG - Intergenic
980310615 4:131125366-131125388 TAAAACTCCAAAATGCAGCTCGG + Intergenic
980882490 4:138726632-138726654 TAAAATTTAAAAATGCTAATGGG + Intergenic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982143523 4:152355637-152355659 GGAATTTCAATAATGCTTCTAGG - Intronic
982191394 4:152859220-152859242 AAAAATACAAAAATTCAGCTGGG - Intronic
982895011 4:160909265-160909287 GAAACTTCAAATATACTGTTTGG - Intergenic
983072252 4:163282289-163282311 GTAAATTGAAAAATATTGCTAGG - Intergenic
983165135 4:164466907-164466929 CAAAATTCAAAAATGATACGAGG + Intergenic
983574355 4:169244266-169244288 AAAAATTTAAAAATGGTGGTGGG - Intronic
983608784 4:169619889-169619911 GCATTTTCAAAAATACTGCTTGG - Intronic
983816258 4:172130349-172130371 GAAAATTAAGAAATGATTCTTGG - Intronic
984137239 4:175956018-175956040 TAAAATACCAACATGCTGCTAGG + Intronic
984776929 4:183490023-183490045 TAAATTTCAAAAATGAGGCTGGG - Intergenic
985543298 5:496892-496914 AAAAATACAAAAACTCTGCTGGG + Intronic
986047508 5:4053600-4053622 AAAAATTCAGAAATTCTGGTTGG - Intergenic
986210441 5:5666674-5666696 GAAAATGCAGAAACTCTGCTTGG + Intergenic
986234472 5:5894290-5894312 GAAGATTCAAGAATGATACTTGG - Intergenic
987144836 5:14982080-14982102 GAAAATACAAAAAAATTGCTGGG + Intergenic
987647270 5:20690165-20690187 CAAAATGCAAAAAGGCTTCTGGG + Intergenic
988170472 5:27648658-27648680 AAAAATACAAAAATTCAGCTGGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
989428572 5:41325458-41325480 CAATATTCAAAAAAGCTCCTTGG - Intronic
990280456 5:54245531-54245553 GCAAGTTCAAAAATGCTCCCTGG + Intronic
990589861 5:57250838-57250860 GAAAATACATAAATGCGGCCAGG - Intronic
991045655 5:62220010-62220032 GAAACCTCAAAATTGCTGATTGG + Intergenic
991591511 5:68256523-68256545 AAAAATTACAAAATGTTGCTGGG - Intronic
991668878 5:69027133-69027155 TAAGATTCAAAATTACTGCTTGG + Intergenic
991689104 5:69209225-69209247 GAAAGTAGAAGAATGCTGCTGGG + Intronic
991855188 5:70960854-70960876 AAAAATACAAAAATTATGCTGGG - Intergenic
992973067 5:82082852-82082874 GAAAATTAAAAAATACTGGGGGG + Intronic
993693153 5:91027492-91027514 GGAAAGTCAAAAAGGCTACTGGG + Intronic
994805110 5:104436587-104436609 TATTATTCAAAAATGGTGCTTGG - Intergenic
994973235 5:106770658-106770680 AAAAATTCAAAAGTGCTTGTGGG - Intergenic
994996555 5:107071209-107071231 GAAAAGTCAAAATTACTCCTTGG + Intergenic
995612206 5:113922876-113922898 GAAAATTCAAAGAAGCGGATAGG + Intergenic
995768020 5:115639854-115639876 GACAATTGAAAGATGTTGCTGGG + Intergenic
996830290 5:127733110-127733132 AAAAATTCAAAAATGCAAGTGGG - Intergenic
998193489 5:140046188-140046210 GTATATTAAAAAATGCGGCTGGG + Intergenic
998494912 5:142580021-142580043 GAAAATTCAAAAAATTAGCTGGG - Intergenic
998547783 5:143045836-143045858 GAAAATACAAAAATTAGGCTGGG + Intronic
999674619 5:153986808-153986830 GAAAAGCCAAAAATGCTCCTGGG - Intergenic
999747580 5:154604105-154604127 GAAAGTGCCTAAATGCTGCTGGG + Intergenic
1000135065 5:158340030-158340052 TAACATTCAAAAATGCATCTTGG + Intergenic
1000420368 5:161031777-161031799 GAACATTCACAAATGCTGGGAGG + Intergenic
1000473283 5:161672934-161672956 AAAAAGTCAAAAATAATGCTGGG - Intronic
1000575625 5:162971745-162971767 GATAATACAAAAATTATGCTAGG - Intergenic
1000699655 5:164433083-164433105 GAAAATGCCAGGATGCTGCTTGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003235168 6:4288944-4288966 TAACATTCAACAATTCTGCTGGG + Intergenic
1004037485 6:11937506-11937528 GAGAATTCATAAATGGTTCTAGG - Intergenic
1004058546 6:12166269-12166291 CTAAATTCAAAAATAATGCTTGG + Intergenic
1004385956 6:15172902-15172924 TAAAATTAAAAAATACAGCTGGG + Intergenic
1005218587 6:23560501-23560523 GAAGATTCAACAAGGCCGCTGGG - Intergenic
1005536047 6:26756702-26756724 GAAATTTAATAAATGGTGCTGGG + Intergenic
1005846558 6:29784648-29784670 GAAACTTAATAAATGGTGCTGGG + Intergenic
1006689048 6:35863949-35863971 AGACAGTCAAAAATGCTGCTGGG + Intronic
1006857270 6:37143382-37143404 GAAAATACAAAAATCCTACATGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1008934945 6:56980971-56980993 AAAAATACAAAAAAGTTGCTGGG - Intronic
1009790276 6:68392960-68392982 AACAATTCATAAATGGTGCTTGG - Intergenic
1010510614 6:76714251-76714273 AACAATACAAAAATGTTGCTAGG - Intergenic
1011491253 6:87895848-87895870 GAAAATTCAAAAATATTCCTCGG + Intergenic
1011960352 6:93081034-93081056 TAAATTGCAAAAATGCTGTTTGG - Intergenic
1012000917 6:93653910-93653932 CACAATTCAAAAATACTTCTGGG - Intergenic
1012319715 6:97827786-97827808 GGAAATTCAATATTGCTGCAAGG - Intergenic
1012550758 6:100463439-100463461 AAAAGTCCAAAAATGCTGCGCGG - Exonic
1013248262 6:108308864-108308886 AAAAATACAAAAAAGCAGCTGGG - Intronic
1013277443 6:108599260-108599282 TAAAATTAAAAAATCTTGCTAGG + Intronic
1013392397 6:109699661-109699683 GAAAATTCAAAAAATTAGCTGGG - Intronic
1014034610 6:116751302-116751324 GATAATTCAGTAATGGTGCTGGG + Intergenic
1014577878 6:123095739-123095761 AAAAATTAGAAAAAGCTGCTGGG - Intergenic
1014659674 6:124153540-124153562 GAAAATTACAAAATGCTTCCTGG - Intronic
1015458597 6:133461401-133461423 TCAAATTCAAAAATGCTGGCTGG + Intronic
1015488003 6:133793586-133793608 AAAAATTAACAAATGCTGGTGGG - Intergenic
1015556096 6:134462950-134462972 AAAAACACAAAAATGTTGCTGGG - Intergenic
1015750842 6:136556810-136556832 AAAAACTCAAAAATTCAGCTAGG - Intergenic
1017093724 6:150785197-150785219 AAAGAATCAAAAATGCTTCTGGG + Intronic
1017477902 6:154817289-154817311 GGAAAATCCAAAATGCTACTTGG - Intronic
1019813467 7:3182326-3182348 AAAAATTCAAAAATGTAGCCAGG - Intergenic
1019821611 7:3247901-3247923 AAAAAATCAAAAAAGTTGCTGGG + Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020542963 7:9484713-9484735 GAAAATACAAAAAAACTACTGGG - Intergenic
1020811604 7:12855899-12855921 AAAAATTCAAAAAATCAGCTGGG - Intergenic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1020960068 7:14791124-14791146 GAAAACTAAAAAATTCTGCCAGG - Intronic
1021005712 7:15392498-15392520 TAAAAGTCAAAAATGCTTTTAGG + Intronic
1021328279 7:19301799-19301821 GAAAATTTAAAATTCCTGATTGG - Intergenic
1021540455 7:21751496-21751518 GCCAATTTAAGAATGCTGCTAGG + Intronic
1021599638 7:22352419-22352441 AAAAATTCATCAATGCTCCTTGG + Intronic
1022450376 7:30508270-30508292 GAAATTTTAAAAATGTGGCTGGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023320075 7:38986640-38986662 AAAAATTCAAAAATACTCATAGG - Intronic
1023684905 7:42723950-42723972 GACAATTGATAAATGCTGCAAGG + Intergenic
1024663640 7:51523063-51523085 GAAAACTTAGAGATGCTGCTGGG + Intergenic
1024841264 7:53590505-53590527 AAAAATTCAAAAAATCAGCTGGG - Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1027660592 7:80983773-80983795 GAAAATTCATATAAGCTGCCTGG - Intergenic
1027919157 7:84369899-84369921 GATGATTCAGAAATGCAGCTAGG + Intronic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1028683109 7:93561416-93561438 GAAAAAGCAAAAATGCTATTAGG - Intronic
1029728053 7:102421246-102421268 AAAAATTGAAAAATGAGGCTGGG + Intronic
1029841519 7:103369193-103369215 GAAAAATCAAGAATGTTGGTTGG - Exonic
1030296768 7:107936712-107936734 TCACATTCAAGAATGCTGCTTGG - Intronic
1032232684 7:130089196-130089218 AAAAATTGAAAAAGACTGCTGGG + Intronic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1032555380 7:132827668-132827690 AAAATCTCAGAAATGCTGCTTGG + Intronic
1033171620 7:139089521-139089543 GAAAATTCAAAATTAATGCCAGG - Intronic
1034546521 7:151793343-151793365 GGAAAGGCAGAAATGCTGCTGGG - Intronic
1034853013 7:154513815-154513837 GCATATTCAGAAGTGCTGCTGGG - Intronic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1035514668 8:222454-222476 AAAAATACAAAAAAGTTGCTGGG + Intergenic
1035864183 8:3064042-3064064 GAAAATTGAAAAGTACTGATTGG - Intronic
1035968341 8:4220108-4220130 GAAAATACAAAAAATCAGCTGGG - Intronic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037782959 8:21883517-21883539 GAAAATACAAAAAATCAGCTAGG + Intergenic
1038976366 8:32701069-32701091 GAAAGTTCCAAAAGGCTTCTAGG - Intronic
1039629238 8:39090766-39090788 CAAACTTCAAAAATGCAGATGGG - Intronic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041216139 8:55602534-55602556 GAAAATTATAAAACGTTGCTAGG - Intergenic
1041228023 8:55719649-55719671 GAAAATTTAAAAATTCGGCTGGG + Intronic
1041328067 8:56690532-56690554 ATAAATTCAAAAAAGCTGGTGGG - Intergenic
1042524787 8:69753047-69753069 GAGAATTCAAAAATGATTTTTGG - Intronic
1042531957 8:69825065-69825087 CAAAATTCAACAATGCTTCATGG + Intronic
1043560764 8:81490439-81490461 GCAAATTGAAAAATGCTGAGTGG + Intergenic
1044367962 8:91372464-91372486 GCTTATTCAAAAATGGTGCTGGG - Intronic
1044869222 8:96601917-96601939 AAAAATTCAAAAATTTAGCTGGG - Intronic
1045303987 8:100940821-100940843 AAAAATTCAAAAAGACTGCATGG + Intronic
1046178867 8:110615921-110615943 AAAAATTCAAAAATTGGGCTAGG - Intergenic
1046312716 8:112459432-112459454 GAAGAGTCAAAAGTGTTGCTAGG + Intronic
1047374198 8:124280796-124280818 TAATATTCACAAAAGCTGCTGGG + Intergenic
1047742925 8:127821513-127821535 GAAAATTAAAAATTACTGCCGGG + Intergenic
1049618310 8:143586155-143586177 GAAAAATCAGACATGCTGCTTGG + Intronic
1049996950 9:1043212-1043234 GAAAATGCAAAAGGCCTGCTCGG - Intergenic
1050214367 9:3306018-3306040 AAAAATTTATAAATTCTGCTAGG + Intronic
1050759117 9:9044382-9044404 AAATATTTAAACATGCTGCTTGG + Intronic
1051213633 9:14773068-14773090 CAATATTTAAAAATGCTTCTGGG - Intronic
1052381454 9:27775365-27775387 GAAAAAGCAAAGATGCTGTTTGG - Intergenic
1052538213 9:29775294-29775316 GAACATTCTAAAATTCAGCTAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053248806 9:36557407-36557429 TTAAATTAAACAATGCTGCTGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055717677 9:79136018-79136040 CAATATACAAAAAAGCTGCTTGG + Intergenic
1055966975 9:81874840-81874862 GAAGATTCAAGGATGCTGCTTGG + Intergenic
1056053429 9:82794702-82794724 GATAATTCAAAACTTCTTCTGGG + Intergenic
1056455818 9:86758756-86758778 GAGAATTCAAGAATGATTCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057125392 9:92612245-92612267 GAAACTTCAAAATTACTGGTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057789579 9:98115541-98115563 AAAAATACAAAAATTGTGCTGGG - Intronic
1058280364 9:103105471-103105493 GAAAATTCAAAAAATTAGCTGGG - Intergenic
1058284407 9:103157893-103157915 GAAATTTCTGATATGCTGCTGGG + Intergenic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058632517 9:107003799-107003821 GCATATTTAAAATTGCTGCTGGG + Intronic
1058746289 9:107994411-107994433 GGAAATTTAAACATGGTGCTGGG - Intergenic
1058912153 9:109531205-109531227 GACAATTGAAAACTGCTGTTAGG - Intergenic
1059069142 9:111117133-111117155 AAAAATACAAAAATTTTGCTGGG + Intergenic
1059183412 9:112242290-112242312 TGAAATTTAAAAATGTTGCTGGG - Intronic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059538568 9:115108162-115108184 AAAAATCCAAACATACTGCTTGG - Intronic
1059644507 9:116251396-116251418 CCAAATTCGAAAATGCTGTTGGG + Intronic
1060095391 9:120784622-120784644 GAAAAAAAAAAAATGCGGCTGGG + Intronic
1060808335 9:126593033-126593055 GAAAATACAAAAAATTTGCTGGG + Intergenic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1202784644 9_KI270718v1_random:37240-37262 GTGATTTCAAAAGTGCTGCTTGG + Intergenic
1185626368 X:1485296-1485318 TAAAATTCAAAAATGTAGCTGGG - Intronic
1185886390 X:3787094-3787116 GAAAATCGAACAATGCTGCCAGG - Intergenic
1185923043 X:4115118-4115140 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1186060283 X:5698135-5698157 GAATATTAAACAATGCTTCTTGG + Intergenic
1186256190 X:7723123-7723145 GAAAGTTTAAACATGCTGCTTGG - Intergenic
1186417062 X:9393053-9393075 AAAAATTAAAAAATGTGGCTGGG + Intergenic
1186435663 X:9541099-9541121 AAAAACACAAAAATGTTGCTTGG + Intronic
1186852950 X:13598185-13598207 GGAAATTGAAAAATGCTGATTGG - Intronic
1187328451 X:18313775-18313797 GAAAATTCATACATACTGGTTGG - Intronic
1189850705 X:45173729-45173751 AAAAATTCAAAAATTTAGCTGGG - Intronic
1189923425 X:45926947-45926969 GAAAATTCAAAAATTCTTGTTGG - Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190530543 X:51369867-51369889 GATAATTCAAAATGGCTGTTTGG + Intergenic
1190731831 X:53231728-53231750 GAAAACTAAAAAATGTTGATTGG + Intergenic
1190733655 X:53241075-53241097 CAAAATTTAAAAAAGATGCTTGG - Intronic
1192068493 X:67911824-67911846 GAAAATTCCAATATGCAGCCAGG + Intergenic
1196576448 X:117324686-117324708 GAGAATTCAAAATAGCTGTTTGG - Intergenic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197531368 X:127631268-127631290 AAAAATACAAAATTTCTGCTTGG - Intergenic
1197647045 X:129029007-129029029 TAATATTAAAAAATGCGGCTGGG + Intergenic
1198144126 X:133837758-133837780 AAAATGTCAAAAATGCTTCTTGG - Intronic
1198247182 X:134841532-134841554 GAAAATTTAAAAATTTGGCTGGG + Intronic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1198633935 X:138674354-138674376 GAAAATACAACCATGCTGATTGG - Intronic
1198757589 X:139997262-139997284 GAAAATACAAAAAATCTGCTGGG + Intergenic
1199279858 X:145988607-145988629 AAAAACTCAAAAAGTCTGCTAGG + Intergenic
1199795627 X:151192637-151192659 GAGAATTCAAAATAGCTGTTTGG + Intergenic
1202022572 Y:20480992-20481014 GAAAATTCAACAACGCTTCATGG + Intergenic