ID: 1124010240

View in Genome Browser
Species Human (GRCh38)
Location 15:25832294-25832316
Sequence ATAACAGATTACCATACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2521
Summary {0: 1, 1: 3, 2: 15, 3: 340, 4: 2162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124010240_1124010244 8 Left 1124010240 15:25832294-25832316 CCTGGTGTATGGTAATCTGTTAT 0: 1
1: 3
2: 15
3: 340
4: 2162
Right 1124010244 15:25832325-25832347 CAGGAAACTCATTCAGCAATGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1124010240_1124010245 11 Left 1124010240 15:25832294-25832316 CCTGGTGTATGGTAATCTGTTAT 0: 1
1: 3
2: 15
3: 340
4: 2162
Right 1124010245 15:25832328-25832350 GAAACTCATTCAGCAATGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1124010240_1124010243 7 Left 1124010240 15:25832294-25832316 CCTGGTGTATGGTAATCTGTTAT 0: 1
1: 3
2: 15
3: 340
4: 2162
Right 1124010243 15:25832324-25832346 TCAGGAAACTCATTCAGCAATGG 0: 1
1: 0
2: 2
3: 26
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124010240 Original CRISPR ATAACAGATTACCATACACC AGG (reversed) Intronic
Too many off-targets to display for this crispr