ID: 1124013567

View in Genome Browser
Species Human (GRCh38)
Location 15:25858963-25858985
Sequence GTGCCTTGCAAGGGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124013567_1124013575 5 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013575 15:25858991-25859013 ATTTCTGGGAGCAGGGCTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 261
1124013567_1124013572 -3 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013572 15:25858983-25859005 CACACTCCATTTCTGGGAGCAGG 0: 1
1: 0
2: 4
3: 19
4: 335
1124013567_1124013571 -9 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013571 15:25858977-25858999 GCAAGGCACACTCCATTTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 159
1124013567_1124013576 20 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013576 15:25859006-25859028 GCTCCAGGTCTGCTGATTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1124013567_1124013573 -2 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013573 15:25858984-25859006 ACACTCCATTTCTGGGAGCAGGG 0: 1
1: 0
2: 6
3: 129
4: 1554
1124013567_1124013570 -10 Left 1124013567 15:25858963-25858985 CCAGCAGCACCCTTGCAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1124013570 15:25858976-25858998 TGCAAGGCACACTCCATTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124013567 Original CRISPR GTGCCTTGCAAGGGTGCTGC TGG (reversed) Intronic
900762798 1:4484058-4484080 GTGCCTGGCCAGGATGCTCCTGG + Intergenic
901083271 1:6595683-6595705 CTACCTGGCAAGGGTGCTGCTGG - Intronic
902491656 1:16786713-16786735 CTGCCCTGCAAAGGTTCTGCTGG - Intronic
904757698 1:32777678-32777700 GTGCTTTGCAAGGCTGAGGCGGG + Intronic
905920030 1:41713140-41713162 GTGCCTACCAAGCCTGCTGCAGG - Intronic
906323211 1:44829231-44829253 GGGCCTTGCCGGGGTACTGCTGG - Exonic
907261600 1:53222412-53222434 GAGCCTGGCAAGGGGGCTTCGGG - Intergenic
907916569 1:58875222-58875244 GAGCCGTGCCAGGTTGCTGCGGG + Intergenic
924657833 1:245989521-245989543 GTTTCTTGCAAGCCTGCTGCAGG - Intronic
924804024 1:247348222-247348244 CTCCCTTGCAGGGGTGCAGCTGG + Intergenic
1062840381 10:666026-666048 GGGCCTTTCCAGGGTGCTGCCGG - Intronic
1067055442 10:43047130-43047152 GTGGCTGGCATGGGAGCTGCAGG - Intergenic
1067093325 10:43282855-43282877 GTTCCTTGCAGAGCTGCTGCTGG - Intergenic
1071744695 10:88403786-88403808 GTGCTTTGCAAGGCCGATGCAGG + Intronic
1072554796 10:96506620-96506642 GGGCCTGGCATGGGTGCTGAGGG - Intronic
1073248915 10:102109921-102109943 ATGCATGGCAAGGATGCTGCGGG + Exonic
1076030332 10:127152445-127152467 GTGCCATGCCAGGCTGCTGCAGG + Intronic
1076803592 10:132844173-132844195 GGGCGTTCCCAGGGTGCTGCGGG + Intronic
1076857899 10:133126622-133126644 GGGCCTGGCAACGGTGCTGAGGG - Intronic
1077503839 11:2921371-2921393 GTCCCCTGCAGAGGTGCTGCAGG + Intronic
1079116465 11:17643480-17643502 CTTCCTTGGAAGGATGCTGCAGG + Exonic
1081710864 11:45214449-45214471 GTGCCTTCCAAGGCTGTTCCTGG + Intronic
1082172658 11:49024886-49024908 GTGCCTTGGAAGGTTGAAGCAGG + Intergenic
1084420070 11:69056054-69056076 GTGCCTTTCCAGGGAGGTGCAGG + Intronic
1084469985 11:69353844-69353866 GTCCCTTCCAACGGTGCAGCGGG + Intronic
1084569958 11:69953386-69953408 GTTCCATCCAAAGGTGCTGCTGG - Intergenic
1086817808 11:91394834-91394856 GTGGCTAGCAGGGGGGCTGCGGG - Intergenic
1088795358 11:113262839-113262861 TTGCCTCCCAAGGTTGCTGCAGG - Intronic
1089359887 11:117878653-117878675 GTTCCATCCAAGGGTACTGCTGG + Intergenic
1089514684 11:119025030-119025052 GTGCTTGGCAATGGTGCTGAAGG + Exonic
1089538129 11:119173148-119173170 GTGCATTGCAAGAGTATTGCAGG - Intronic
1090204332 11:124876327-124876349 GCGGCTGGCGAGGGTGCTGCGGG + Exonic
1090982079 11:131731874-131731896 GTTCCATGCATTGGTGCTGCTGG + Intronic
1092117907 12:6022609-6022631 CTGACCTGCAAGGCTGCTGCAGG - Intronic
1092960494 12:13592452-13592474 GTGCATTGCAAGAGTGCAACAGG - Intronic
1094240246 12:28213891-28213913 GTGCCTTGAAAGGCTGGTGCAGG + Intronic
1095097832 12:38157619-38157641 GGGCCTGGCAAAGGGGCTGCCGG - Intergenic
1097291358 12:57918423-57918445 TTGCCTTGCAAGGATGCAACAGG - Intergenic
1098223846 12:68299989-68300011 CTGCCTTGTAAGGTTTCTGCTGG - Intronic
1100168898 12:91950067-91950089 ATGTCTTGCAAGGTTGTTGCGGG - Intergenic
1103904158 12:124318970-124318992 TTGTCTCGCAAGGGTGCTGATGG - Intergenic
1104832910 12:131766599-131766621 GTGCCTCCCATGGGTCCTGCTGG + Intronic
1104963569 12:132499217-132499239 GTGCCGGGCAGGGGTGGTGCCGG + Intronic
1104963576 12:132499233-132499255 GTGCCGGGCAGGGGTGGTGCTGG + Intronic
1106017491 13:25883594-25883616 GTGCCTTGCACTGGTCCTGTGGG + Intronic
1106611225 13:31283169-31283191 GTCCCCAGCAAGGGTCCTGCAGG - Intronic
1109054879 13:57534386-57534408 GTGCCTTGCAAGGGGAATACTGG + Intergenic
1109781439 13:67115360-67115382 ATGCTTTGCATGTGTGCTGCTGG + Intronic
1109957017 13:69581724-69581746 GTGCCTTGGGAGGCTGCAGCAGG + Intergenic
1111505605 13:89184869-89184891 GTGCCTTGGAAGGGACCTGGTGG - Intergenic
1112371528 13:98798082-98798104 GCTGCTTGCAAGGGTGGTGCAGG - Intronic
1112809665 13:103203371-103203393 GTGATTTACTAGGGTGCTGCAGG + Intergenic
1113719619 13:112544950-112544972 GTGCCTTGTGTGGGCGCTGCTGG - Intronic
1114252348 14:20971954-20971976 GTGCTTTGCGAAGTTGCTGCCGG + Intergenic
1114410274 14:22494283-22494305 TTTCGTTGCAAAGGTGCTGCTGG - Intergenic
1119218907 14:72891182-72891204 GAGCCCTGCATAGGTGCTGCTGG + Intronic
1122860394 14:104579890-104579912 GGGCCTGGGAGGGGTGCTGCCGG + Exonic
1123078217 14:105679898-105679920 GGGCCTTGCAAGGCTGCACCTGG - Intergenic
1123406415 15:20021775-20021797 GTGCCTTCCCAGAGTGCTGCTGG + Intergenic
1123409352 15:20045591-20045613 GTTCCTTACAGGGGTGCTGTGGG - Intergenic
1123515745 15:21028423-21028445 GTGCCTTCCCAGAGTGCTGCTGG + Intergenic
1123518683 15:21052299-21052321 GTTCCTTACAGGGGTGCTGTGGG - Intergenic
1124013567 15:25858963-25858985 GTGCCTTGCAAGGGTGCTGCTGG - Intronic
1124340569 15:28886898-28886920 CTGCCTGGCAAGGCTGCTGGCGG + Intronic
1124966529 15:34436742-34436764 CTGCCTGGCAAGGCTGCTGGAGG - Intronic
1124983136 15:34582833-34582855 CTGCCTGGCAAGGCTGCTGGAGG - Intronic
1128700212 15:69798520-69798542 CTGCCATCCCAGGGTGCTGCTGG - Intergenic
1129372373 15:75105603-75105625 ATGCCTTCCAAGGGTGCAGGGGG - Intronic
1129968613 15:79758210-79758232 GGGCATATCAAGGGTGCTGCTGG - Intergenic
1131150806 15:90046216-90046238 CTGCCTTGGGAGGGTCCTGCCGG - Intronic
1132065803 15:98729880-98729902 GTGCTTTCCAAGGGTTATGCAGG - Intronic
1134273315 16:12753953-12753975 GTTGCTTGCAAGGGTGATCCTGG + Intronic
1135113259 16:19707087-19707109 GGGCCTTGCAATCGTGCTGGCGG + Exonic
1138012435 16:53395066-53395088 GTGCCATGCAAAGCTTCTGCAGG - Intergenic
1139151920 16:64392011-64392033 CTTTCTTTCAAGGGTGCTGCAGG + Intergenic
1139508244 16:67410325-67410347 GAGCCTTGCAAAGATGCAGCTGG - Intronic
1143378938 17:6483722-6483744 GTGTCTTGCAGGAGCGCTGCGGG + Exonic
1143487034 17:7260970-7260992 GTGGCCTGCAAGGCCGCTGCGGG + Exonic
1144194424 17:12876504-12876526 GTGCCTAGCAGGTGTTCTGCTGG - Intronic
1145871177 17:28274705-28274727 GTGCTATGCAAGGGAGCAGCAGG - Intergenic
1146486432 17:33246564-33246586 GAGCCTTGCAAGGGCGCGGCGGG + Intronic
1148349763 17:46932133-46932155 GCGCCATGCAAGGGAGCAGCAGG + Exonic
1149549429 17:57529187-57529209 GCGCTTTGAAAGGCTGCTGCAGG + Intronic
1151156305 17:72125233-72125255 GAGCCTTAAAACGGTGCTGCTGG + Exonic
1152735185 17:81993818-81993840 GTGCCTTGCAAGGGCTCAGGTGG - Intronic
1152798439 17:82320145-82320167 CAGCCTTGCTAGGGTGCTCCAGG - Intergenic
1155234792 18:23808489-23808511 ACACCTAGCAAGGGTGCTGCTGG + Intronic
1155332307 18:24730740-24730762 CTGCCTTGCCAGAGTGCTGGAGG + Intergenic
1155933009 18:31726106-31726128 GTGCTATGCAAGGGAGCAGCAGG - Intergenic
1159038873 18:63304098-63304120 ATGCAGTGCAAGGGTGCTGATGG - Intronic
1163581763 19:18143724-18143746 GTGCCTGGCAGGGGTGATGCAGG + Intronic
1165466404 19:35977558-35977580 GTGCCCTGCAGGGGTGGGGCTGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
924979918 2:210233-210255 GTGCCTGGGAGGGGTGCAGCAGG + Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
926346270 2:11948596-11948618 TTGCCCTGCATGGATGCTGCTGG + Intergenic
927136023 2:20097127-20097149 GTGCCTTGGAAGGGTGTATCTGG - Intergenic
927604053 2:24470484-24470506 CTGCCCAGCAAGGGTGCTCCAGG - Intergenic
929847019 2:45541172-45541194 GTGCCATGCAAGGCTGTGGCTGG + Intronic
929925271 2:46202281-46202303 CTGCCTTGCAGGGTTGCTGGAGG + Intergenic
931976130 2:67646339-67646361 ATGCCTGGGAAGGGTACTGCTGG - Intergenic
934779437 2:96960430-96960452 TTGCCTTGCCAGGATGCTGGTGG - Exonic
935116100 2:100137773-100137795 CTGCCTTGCAGGGGTGTTGTGGG + Intronic
936523945 2:113230220-113230242 GTGCCCTGCAGGGCTGCTTCTGG + Intronic
937888125 2:126914429-126914451 GTGCCTCGCAAGGAAGCTGTGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
947628039 2:231633357-231633379 TTGCCTGGAAAGGGTGGTGCTGG + Intergenic
948378228 2:237536390-237536412 CTACCTTGCAGGGGTACTGCAGG - Intronic
948738338 2:240025478-240025500 GTGCGCTGCCAGGGTCCTGCGGG + Intergenic
1169273320 20:4217003-4217025 GGGCCTTGCAAGGTTGGTGATGG + Intergenic
1171390892 20:24801040-24801062 GTGGCTTGCATGGGTGCCCCTGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172035432 20:32007466-32007488 CTGCCTTGGAAGGCTGCTGCAGG - Intergenic
1173715417 20:45199496-45199518 GTGGAGGGCAAGGGTGCTGCAGG + Intergenic
1174789575 20:53464876-53464898 GTGACTTGCAAGGCTGAGGCAGG - Intronic
1174868991 20:54166115-54166137 GGCCCTAGCAAAGGTGCTGCAGG + Intronic
1177321056 21:19521551-19521573 GTGCTTGGCAATGGTGTTGCAGG - Intergenic
1178746064 21:35251412-35251434 CTGCCTTGCTAGGCTGCTGGAGG - Intronic
1179189826 21:39114385-39114407 GTGCCTGGCCCGGGTGCTACTGG - Intergenic
1179840987 21:44073254-44073276 GTGCCTTGCAAGAGTTCTTATGG + Intronic
1180569342 22:16701023-16701045 CTGACCTGCAAGGCTGCTGCAGG - Intergenic
1180619199 22:17148703-17148725 GTGCCTTTCAGAAGTGCTGCTGG - Intronic
1180641861 22:17305296-17305318 TTGCCTTGGCAGGGTGGTGCTGG - Intergenic
1180969118 22:19805834-19805856 GGGCCTGGGAAGAGTGCTGCTGG + Intronic
1184424850 22:44403370-44403392 GTGCCCTACCAGGCTGCTGCAGG + Intergenic
949169107 3:977363-977385 CTTCCTTGAAAGGATGCTGCTGG - Intergenic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
950155411 3:10718094-10718116 TTGCCTTGCAGGGCTGTTGCAGG + Intergenic
950575144 3:13827818-13827840 GTGCCTGCCATGGGTGCTGGGGG - Intronic
950966710 3:17151856-17151878 GTGCGTGGCAAGGCTGCCGCTGG - Intergenic
953722321 3:45367222-45367244 GTGCTTTGGAAGGCTGATGCGGG - Intergenic
954422266 3:50424956-50424978 TTGGCTTACAGGGGTGCTGCTGG - Intronic
954590398 3:51777688-51777710 CTGCCTTGGGTGGGTGCTGCTGG - Intergenic
955499847 3:59572929-59572951 GAGCCTTGCAAAGGTGCAGGGGG - Intergenic
955920327 3:63948127-63948149 GTTCATTGAAAGGGTGCTGGTGG + Intronic
959888172 3:111526028-111526050 TTGCCTTGCACTGGTGCTGATGG + Intronic
959904291 3:111693481-111693503 GTGACTTGCAAGGATGAGGCAGG - Intronic
960976425 3:123179307-123179329 GTGCCTTGCAACCGTGATGTGGG - Intronic
965245669 3:166263857-166263879 GTGCCATGCTGGTGTGCTGCAGG - Intergenic
968193950 3:196691512-196691534 GTGCCTTGCTGGGCTGCTGTAGG + Intronic
968292639 3:197550615-197550637 GGGCCATGCAATGGCGCTGCTGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
973186859 4:47340196-47340218 CTTCCTTGCTTGGGTGCTGCAGG - Intronic
980480876 4:133385494-133385516 GCTCCTTGCAAGGCTGCAGCTGG - Intergenic
985440337 4:189979345-189979367 GTACCGTGCAGGGGGGCTGCCGG + Intergenic
988073384 5:26324106-26324128 GCTCCCTGCAAGGTTGCTGCTGG + Intergenic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
993562993 5:89435175-89435197 GTGTCTTTCAAAGGTGCTGTTGG - Intergenic
995811575 5:116113153-116113175 CTGCCTTGTAAGGTTTCTGCTGG + Intronic
1000877170 5:166655261-166655283 GTACCTTGCATTGGTGCTTCAGG + Intergenic
1003242213 6:4354450-4354472 CTGCCTGCCAAGGCTGCTGCAGG - Intergenic
1004243650 6:13951932-13951954 GAGCCTTGCCAGGTTGATGCTGG - Intronic
1005829182 6:29657014-29657036 GTGCCTGGCAAGGGTGACGTGGG + Intronic
1006259245 6:32854217-32854239 GTGCCTTGCAGGGATGCTGCGGG + Exonic
1006335956 6:33420536-33420558 GGGCCTTGAAAGGGGGCTGAAGG + Intronic
1007258368 6:40544478-40544500 GTACCCAGCCAGGGTGCTGCAGG - Intronic
1010172252 6:72987539-72987561 GGACCTTGCAATCGTGCTGCGGG - Intronic
1012568477 6:100691934-100691956 CTGCCTTACAAGGGTGCTGTGGG + Intronic
1013192548 6:107815965-107815987 CTGCCTGGCAGGGCTGCTGCAGG - Intronic
1014165642 6:118221303-118221325 GTGCCTTGCCCTTGTGCTGCGGG - Intronic
1017014588 6:150089795-150089817 GTGCCTTGCAAAAGGGCTGAAGG - Intergenic
1018167887 6:161116414-161116436 GAGCCTTGCAAGGGCCCTGCAGG + Intronic
1021895742 7:25233659-25233681 GTGCCCTGGAAGTATGCTGCTGG - Intergenic
1022515130 7:30970430-30970452 GTGCCTGGCAAAGGCCCTGCTGG - Intronic
1022706886 7:32810262-32810284 GTGCCAGGCAGGGGCGCTGCTGG - Intergenic
1026499784 7:70934667-70934689 CAGCTTTGCAATGGTGCTGCAGG - Intergenic
1027175216 7:75899080-75899102 GTGCCTAGCAGGGGTACTGAGGG + Intergenic
1029638864 7:101805422-101805444 GTACCTTGCAAAGCTGCTACTGG + Intergenic
1033682756 7:143611834-143611856 CTGGCCTGCAAGGTTGCTGCTGG + Intergenic
1033701859 7:143845809-143845831 CTGGCCTGCAAGGTTGCTGCTGG - Intergenic
1034131809 7:148725492-148725514 GTTCCCTGCCAGGGTGATGCTGG + Intronic
1034866126 7:154643982-154644004 GTGCCCTGCCAGGCTGCTGCTGG + Intronic
1035022816 7:155809114-155809136 GTGCCAGGCGAGGGTGCTGGCGG - Intronic
1035356246 7:158277580-158277602 GTGCCTTCAAGGGGTGCTTCTGG - Intronic
1036773502 8:11594281-11594303 GGGCCTTTCAAGGCTGCTGATGG + Intergenic
1037182756 8:16027023-16027045 GTGCCTTATAAAAGTGCTGCAGG - Intergenic
1038416143 8:27397403-27397425 GTGCCTTGCAGGGGAGCTTTTGG + Intronic
1038609348 8:29045527-29045549 GTGCCTTGGCATGGTGCTCCCGG + Intronic
1039917025 8:41867608-41867630 GTGTGTGGCATGGGTGCTGCCGG - Intronic
1046024483 8:108705687-108705709 GTACCTTACAAGGTGGCTGCAGG + Intronic
1047104699 8:121719972-121719994 GTGCCATGCATGGCTGCCGCAGG - Intergenic
1047568706 8:126074032-126074054 GGGCCTTGCAATCGTGCTGGGGG - Intergenic
1049426695 8:142540995-142541017 GTGCCTGGCAAGGTGGCTGAAGG + Intronic
1049567351 8:143348018-143348040 CTGGCTTGCAAGGCTGCTGTGGG - Intronic
1049567460 8:143348518-143348540 GTGCCCTGCAGGGGTGTGGCAGG + Intronic
1049756475 8:144313313-144313335 GTGCCCTGCAGGGGTGCGGCTGG - Intronic
1049971638 9:826743-826765 GTGCCCAGCACGGGAGCTGCAGG + Intergenic
1057495190 9:95554915-95554937 GTGCCTTGTAAGAGGGCTGGAGG + Intergenic
1057781422 9:98053990-98054012 GAGCCTTGCTAGGGTGATACTGG - Intergenic
1058794665 9:108486419-108486441 TTGCCTTGGCAGTGTGCTGCAGG - Intergenic
1058836555 9:108862891-108862913 GTGCATTGCAGGGGTGTTGAAGG - Exonic
1060618906 9:125044902-125044924 GCGCCATGCAAGGTTGCAGCTGG - Intronic
1061177542 9:129006729-129006751 CTGGCTGGCAGGGGTGCTGCTGG + Exonic
1062028225 9:134350318-134350340 GGGCCTTCCAAGGCTGCAGCTGG - Intronic
1062334265 9:136058148-136058170 CTGGCTGGCAAGGGGGCTGCTGG + Intronic
1062594538 9:137293137-137293159 GAGCCTTGCACCGGAGCTGCCGG + Intergenic
1186401191 X:9261438-9261460 GTCCCTTGCAATGTTGGTGCAGG - Intergenic
1186502581 X:10064135-10064157 GTGCCTGGGAGAGGTGCTGCTGG + Intronic
1187199688 X:17123091-17123113 GTGCCTTTCAATTGTGCTGCTGG + Intronic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1193921534 X:87433707-87433729 GTGCCTGCAAAGGGTGCTGGGGG + Intergenic
1196270194 X:113700498-113700520 GTGCATTACAAGGCTGCTGCTGG + Intergenic
1201344152 Y:12964970-12964992 GTGACATACAAGGGTGCTGGAGG + Intergenic