ID: 1124014186

View in Genome Browser
Species Human (GRCh38)
Location 15:25862476-25862498
Sequence GGCGGCGCTGTGGCTTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014178_1124014186 11 Left 1124014178 15:25862442-25862464 CCCTTTAGCTGCGGCGGAGGCAC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014179_1124014186 10 Left 1124014179 15:25862443-25862465 CCTTTAGCTGCGGCGGAGGCACA 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014171_1124014186 27 Left 1124014171 15:25862426-25862448 CCCGCATCCAGGGCGCCCCTTTA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014177_1124014186 12 Left 1124014177 15:25862441-25862463 CCCCTTTAGCTGCGGCGGAGGCA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014170_1124014186 28 Left 1124014170 15:25862425-25862447 CCCCGCATCCAGGGCGCCCCTTT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014173_1124014186 20 Left 1124014173 15:25862433-25862455 CCAGGGCGCCCCTTTAGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1124014172_1124014186 26 Left 1124014172 15:25862427-25862449 CCGCATCCAGGGCGCCCCTTTAG 0: 1
1: 0
2: 2
3: 3
4: 65
Right 1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014186 Original CRISPR GGCGGCGCTGTGGCTTCGGT CGG Intronic
900100900 1:961568-961590 GGCGGCGCTGGGGGCTCCGTGGG + Intronic
900394336 1:2446994-2447016 GGCGGCTCTGAGGCTGGGGTGGG - Intronic
901026597 1:6281726-6281748 GGGGCAGCTGTGGCTCCGGTGGG - Intronic
901383823 1:8893438-8893460 GGCGGCGCGCGGGCTTTGGTCGG - Intergenic
902282181 1:15382785-15382807 GGCGGCATTGTGGCTTTGGCAGG - Intronic
906116304 1:43359352-43359374 GCCGGCGCTGTGGGATCGGTTGG - Exonic
908974300 1:69879525-69879547 GGGTCCGCTGTGGCCTCGGTAGG + Intronic
910288808 1:85580868-85580890 GGCGGCGCGGTGGGCCCGGTGGG - Exonic
914686451 1:149984181-149984203 GGAGGTGATGTGGCTTGGGTGGG - Intronic
915348183 1:155208692-155208714 GGCCGGGCTGGGGCTTGGGTGGG - Exonic
915458140 1:156053882-156053904 CGGGGCGCTGTGGCTGCGGCTGG - Intergenic
917135485 1:171784578-171784600 GGCTGGGCTGGGGCTTTGGTGGG + Intronic
923119704 1:230978769-230978791 GGCGGCGCTGTGGCCGCCGCGGG - Exonic
1062867154 10:865441-865463 GAGGGCGCTGTGGCTGCAGTGGG - Intronic
1062927380 10:1327188-1327210 GGAGGCGCTGTGCCTTGGGGAGG - Intronic
1069801420 10:71084257-71084279 GGCGGGGCTGTGGGATTGGTGGG - Intergenic
1070339940 10:75488772-75488794 GGCAGCGCTGTGGCTGAGGGTGG + Intronic
1071813228 10:89206459-89206481 CGCGGTGATGTGGCTGCGGTGGG - Exonic
1075954861 10:126514750-126514772 GGCGGTGCTGTGGCTGCTGAGGG - Intronic
1076513913 10:131032605-131032627 GGCGGCCCTGTGAATTCAGTGGG - Intergenic
1077112529 11:868176-868198 GGGGGTCCTGTGGCTTCTGTTGG - Exonic
1083161028 11:60854225-60854247 GGGGGCGCTGTGGATGCTGTGGG - Intronic
1083430773 11:62612716-62612738 TGCGGCGCTGTGGCACCGGACGG - Exonic
1083740924 11:64711494-64711516 GGCGGGGCTGTGGTGTCGGGGGG - Intronic
1084801791 11:71548833-71548855 AGCGGGGCTGTGGCTCCTGTGGG + Exonic
1085457384 11:76672707-76672729 GGCGGGGCTGGGGCTATGGTGGG + Intergenic
1088695043 11:112359471-112359493 GGTGGTGCTGTGGCTTCCTTTGG - Intergenic
1089580291 11:119477352-119477374 GGCGGGACTGTGGCTTCGCAGGG + Intergenic
1090857823 11:130625750-130625772 GGCGGGACTGGGGCTCCGGTGGG - Intergenic
1101970396 12:109308947-109308969 GGCGGAACTGAGGCTTTGGTGGG - Intronic
1113948824 13:114059956-114059978 GGCAGCACTGTGGCCTCGCTCGG + Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG + Intronic
1129155864 15:73717378-73717400 GGCGGGGCTGTTGCTTGGGTAGG - Intergenic
1132649544 16:1014278-1014300 GGCGGGGCTGGGGCTGGGGTGGG + Intergenic
1133155385 16:3871265-3871287 GGCAGCGCTGTGACTTGGGCTGG - Intronic
1133211133 16:4264007-4264029 GCCGGGGCTGCGGCTTCGGGTGG - Intronic
1139558777 16:67728831-67728853 GGCAGCTCTGTGGCCTTGGTTGG + Intronic
1141887514 16:86902629-86902651 GGCAGCACTCTGGCTTCAGTTGG - Intergenic
1160843487 19:1156685-1156707 GTCTGCGCTGTGGCCTAGGTCGG - Intronic
1161007506 19:1943903-1943925 GGCAGCGCTGTGGGTGCTGTTGG + Intronic
1161172435 19:2819771-2819793 GGCGGCGCTGTGACCCAGGTTGG + Intergenic
1161323988 19:3654300-3654322 GGGGGCGCTGTTGCTTCACTTGG - Intronic
1164435247 19:28223119-28223141 GGCTGCCATGTGGCTTCGGATGG - Intergenic
1165145564 19:33727899-33727921 GGCTGGGCTGTGCCTTCTGTGGG + Intronic
1166000061 19:39872469-39872491 GACGGCTCTGTGGCCTCTGTGGG - Exonic
1166995806 19:46719216-46719238 GGCGGGGCTGAGGCTTCAGCTGG + Intergenic
1167075202 19:47244248-47244270 GGCGGCCCCGTGGCTTCCGGAGG + Intergenic
941571916 2:167181183-167181205 GGCAGGGCTGTGGCTTGGGCTGG + Intronic
946195755 2:218032377-218032399 GGGGGCGATGTGGCCTGGGTAGG + Intergenic
948732497 2:239975898-239975920 GCTGGTGCTGTGGCTTTGGTTGG - Intronic
1169116923 20:3072022-3072044 GGCGGCGCTGGGGACTCGCTCGG - Intronic
1170374934 20:15689928-15689950 GGAGGGGCTGTGCCTTTGGTTGG - Intronic
1171389905 20:24794702-24794724 GGCTGGGCTGTGGCTTGGGAAGG - Intergenic
1173660081 20:44727223-44727245 GGCGGCGCTGGGTCTCCAGTCGG - Exonic
1176040111 20:63060793-63060815 GGTGGGGCTGTGGCTTGGGCTGG - Intergenic
1176376926 21:6091462-6091484 GGCCGGGCAGTGGCTCCGGTGGG + Intergenic
1179746549 21:43446782-43446804 GGCCGGGCAGTGGCTCCGGTGGG - Intergenic
1179975875 21:44865853-44865875 GGCGTTGCTGTGGCCTCGGATGG - Intronic
1180185425 21:46136910-46136932 GGCAGAGCTGTGACCTCGGTGGG - Intronic
1182295536 22:29309615-29309637 GGCAGCGCTCTGGCTCTGGTGGG + Intronic
1184229854 22:43152524-43152546 GGCGTCTCTGTGGAGTCGGTGGG + Intronic
1185092108 22:48781505-48781527 GGCTGCTGTGTGGCTTCGGGAGG - Intronic
985776867 5:1848903-1848925 GCCTGCGCTGTGGCATCGGTCGG - Intergenic
986152555 5:5140500-5140522 GGCGGCGCTGTGGATGCTGTTGG + Exonic
998094939 5:139391661-139391683 GGAGGTGCTGTGGCTGCCGTGGG - Exonic
998463121 5:142324032-142324054 GGCCGCGCTAGGGCTGCGGTGGG - Intronic
1004256867 6:14072309-14072331 GGCTGCACTCTGGCTTCGGGTGG - Intergenic
1011692974 6:89886996-89887018 GGCGGCGCTGCAGCTTCTGCCGG - Intergenic
1023939750 7:44761927-44761949 GGCGGTGCTGTGGCGTGGGGCGG + Intronic
1027269214 7:76510981-76511003 AGCCGCGCTGTGTCTTCGATGGG + Exonic
1027319928 7:77004876-77004898 AGCCGCGCTGTGTCTTCGATGGG + Intergenic
1035221529 7:157409301-157409323 GGCGGGGCTGTGGCTCCCGTGGG + Intronic
1035362386 7:158322170-158322192 GGCAGAGCTGTGGCTTCCCTGGG - Intronic
1035382018 7:158446430-158446452 GGGGCAGCTGTGGCTTGGGTGGG - Intronic
1035443054 7:158919980-158920002 TGCAGCGCTGTGGCCTCCGTCGG + Intronic
1040315285 8:46257723-46257745 GGCCACGGTGTGGCGTCGGTGGG + Intergenic
1049374312 8:142281739-142281761 GGGGGCGCTGGGGAGTCGGTGGG + Intronic
1049585506 8:143430811-143430833 GGCGGGGCTGGGGCTCCGATTGG - Intergenic
1056481557 9:87011791-87011813 GCTGGCGCTGTGGGATCGGTTGG - Intergenic
1062294804 9:135818789-135818811 GGAGGCTGTGTGGCCTCGGTGGG - Intronic
1062306166 9:135907992-135908014 GGCCGGGCTGTGGCTGAGGTGGG - Intergenic