ID: 1124014217

View in Genome Browser
Species Human (GRCh38)
Location 15:25862601-25862623
Sequence AGCGCGCGGTGGCGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014217_1124014231 28 Left 1124014217 15:25862601-25862623 CCTGCCCTGCGCCACCGCGCGCT 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014217_1124014230 25 Left 1124014217 15:25862601-25862623 CCTGCCCTGCGCCACCGCGCGCT 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358
1124014217_1124014228 16 Left 1124014217 15:25862601-25862623 CCTGCCCTGCGCCACCGCGCGCT 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014217 Original CRISPR AGCGCGCGGTGGCGCAGGGC AGG (reversed) Intronic