ID: 1124014218

View in Genome Browser
Species Human (GRCh38)
Location 15:25862605-25862627
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014218_1124014230 21 Left 1124014218 15:25862605-25862627 CCCTGCGCCACCGCGCGCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358
1124014218_1124014228 12 Left 1124014218 15:25862605-25862627 CCCTGCGCCACCGCGCGCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014218_1124014231 24 Left 1124014218 15:25862605-25862627 CCCTGCGCCACCGCGCGCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014218 Original CRISPR AGCGAGCGCGCGGTGGCGCA GGG (reversed) Intronic