ID: 1124014218 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:25862605-25862627 |
| Sequence | AGCGAGCGCGCGGTGGCGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 67 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1124014218_1124014228 | 12 | Left | 1124014218 | 15:25862605-25862627 | CCCTGCGCCACCGCGCGCTCGCT | 0: 1 1: 0 2: 0 3: 6 4: 60 |
||
| Right | 1124014228 | 15:25862640-25862662 | CAACTCACCTGCTGAAGACCAGG | 0: 1 1: 0 2: 0 3: 7 4: 145 |
||||
| 1124014218_1124014231 | 24 | Left | 1124014218 | 15:25862605-25862627 | CCCTGCGCCACCGCGCGCTCGCT | 0: 1 1: 0 2: 0 3: 6 4: 60 |
||
| Right | 1124014231 | 15:25862652-25862674 | TGAAGACCAGGCAGCCCAGGTGG | 0: 1 1: 1 2: 1 3: 28 4: 331 |
||||
| 1124014218_1124014230 | 21 | Left | 1124014218 | 15:25862605-25862627 | CCCTGCGCCACCGCGCGCTCGCT | 0: 1 1: 0 2: 0 3: 6 4: 60 |
||
| Right | 1124014230 | 15:25862649-25862671 | TGCTGAAGACCAGGCAGCCCAGG | 0: 1 1: 0 2: 2 3: 30 4: 358 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1124014218 | Original CRISPR | AGCGAGCGCGCGGTGGCGCA GGG (reversed) | Intronic | ||