ID: 1124014219

View in Genome Browser
Species Human (GRCh38)
Location 15:25862606-25862628
Sequence GAGCGAGCGCGCGGTGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014219_1124014228 11 Left 1124014219 15:25862606-25862628 CCTGCGCCACCGCGCGCTCGCTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014219_1124014231 23 Left 1124014219 15:25862606-25862628 CCTGCGCCACCGCGCGCTCGCTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014219_1124014230 20 Left 1124014219 15:25862606-25862628 CCTGCGCCACCGCGCGCTCGCTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014219 Original CRISPR GAGCGAGCGCGCGGTGGCGC AGG (reversed) Intronic