ID: 1124014221

View in Genome Browser
Species Human (GRCh38)
Location 15:25862615-25862637
Sequence CGGGCGGGCGAGCGAGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 18, 3: 105, 4: 414}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014221_1124014228 2 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014221_1124014230 11 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358
1124014221_1124014236 30 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014236 15:25862668-25862690 CAGGTGGTTGATCTTGTGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1124014221_1124014233 26 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014233 15:25862664-25862686 AGCCCAGGTGGTTGATCTTGTGG 0: 1
1: 0
2: 2
3: 37
4: 609
1124014221_1124014231 14 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014221 Original CRISPR CGGGCGGGCGAGCGAGCGCG CGG (reversed) Intronic