ID: 1124014223

View in Genome Browser
Species Human (GRCh38)
Location 15:25862631-25862653
Sequence CAGCAGGTGAGTTGGGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 393}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014223_1124014230 -5 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358
1124014223_1124014239 25 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014223_1124014231 -2 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014223_1124014236 14 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014236 15:25862668-25862690 CAGGTGGTTGATCTTGTGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1124014223_1124014237 19 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014237 15:25862673-25862695 GGTTGATCTTGTGGTCGGAGCGG 0: 1
1: 0
2: 1
3: 5
4: 120
1124014223_1124014233 10 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014233 15:25862664-25862686 AGCCCAGGTGGTTGATCTTGTGG 0: 1
1: 0
2: 2
3: 37
4: 609
1124014223_1124014238 22 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014238 15:25862676-25862698 TGATCTTGTGGTCGGAGCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014223 Original CRISPR CAGCAGGTGAGTTGGGCGGG CGG (reversed) Exonic