ID: 1124014225

View in Genome Browser
Species Human (GRCh38)
Location 15:25862635-25862657
Sequence TCTTCAGCAGGTGAGTTGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 302}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014225_1124014237 15 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014237 15:25862673-25862695 GGTTGATCTTGTGGTCGGAGCGG 0: 1
1: 0
2: 1
3: 5
4: 120
1124014225_1124014239 21 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014225_1124014238 18 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014238 15:25862676-25862698 TGATCTTGTGGTCGGAGCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1124014225_1124014230 -9 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014230 15:25862649-25862671 TGCTGAAGACCAGGCAGCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 358
1124014225_1124014236 10 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014236 15:25862668-25862690 CAGGTGGTTGATCTTGTGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1124014225_1124014231 -6 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014225_1124014233 6 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014233 15:25862664-25862686 AGCCCAGGTGGTTGATCTTGTGG 0: 1
1: 0
2: 2
3: 37
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014225 Original CRISPR TCTTCAGCAGGTGAGTTGGG CGG (reversed) Exonic