ID: 1124014228

View in Genome Browser
Species Human (GRCh38)
Location 15:25862640-25862662
Sequence CAACTCACCTGCTGAAGACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014214_1124014228 26 Left 1124014214 15:25862591-25862613 CCCGGGGCGCCCTGCCCTGCGCC 0: 1
1: 0
2: 6
3: 60
4: 530
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014219_1124014228 11 Left 1124014219 15:25862606-25862628 CCTGCGCCACCGCGCGCTCGCTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014220_1124014228 5 Left 1124014220 15:25862612-25862634 CCACCGCGCGCTCGCTCGCCCGC 0: 1
1: 1
2: 12
3: 56
4: 421
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014216_1124014228 17 Left 1124014216 15:25862600-25862622 CCCTGCCCTGCGCCACCGCGCGC 0: 1
1: 0
2: 1
3: 22
4: 298
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014221_1124014228 2 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014217_1124014228 16 Left 1124014217 15:25862601-25862623 CCTGCCCTGCGCCACCGCGCGCT 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014218_1124014228 12 Left 1124014218 15:25862605-25862627 CCCTGCGCCACCGCGCGCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1124014215_1124014228 25 Left 1124014215 15:25862592-25862614 CCGGGGCGCCCTGCCCTGCGCCA 0: 1
1: 0
2: 2
3: 55
4: 401
Right 1124014228 15:25862640-25862662 CAACTCACCTGCTGAAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014228 Original CRISPR CAACTCACCTGCTGAAGACC AGG Exonic