ID: 1124014231

View in Genome Browser
Species Human (GRCh38)
Location 15:25862652-25862674
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 331}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014223_1124014231 -2 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014225_1124014231 -6 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014217_1124014231 28 Left 1124014217 15:25862601-25862623 CCTGCCCTGCGCCACCGCGCGCT 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014226_1124014231 -9 Left 1124014226 15:25862638-25862660 CCCAACTCACCTGCTGAAGACCA 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014219_1124014231 23 Left 1124014219 15:25862606-25862628 CCTGCGCCACCGCGCGCTCGCTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014224_1124014231 -5 Left 1124014224 15:25862634-25862656 CCCGCCCAACTCACCTGCTGAAG 0: 1
1: 0
2: 0
3: 30
4: 305
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014220_1124014231 17 Left 1124014220 15:25862612-25862634 CCACCGCGCGCTCGCTCGCCCGC 0: 1
1: 1
2: 12
3: 56
4: 421
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014218_1124014231 24 Left 1124014218 15:25862605-25862627 CCCTGCGCCACCGCGCGCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014221_1124014231 14 Left 1124014221 15:25862615-25862637 CCGCGCGCTCGCTCGCCCGCCCG 0: 1
1: 0
2: 18
3: 105
4: 414
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014227_1124014231 -10 Left 1124014227 15:25862639-25862661 CCAACTCACCTGCTGAAGACCAG 0: 1
1: 0
2: 2
3: 20
4: 243
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014216_1124014231 29 Left 1124014216 15:25862600-25862622 CCCTGCCCTGCGCCACCGCGCGC 0: 1
1: 0
2: 1
3: 22
4: 298
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331
1124014222_1124014231 -1 Left 1124014222 15:25862630-25862652 CCCGCCCGCCCAACTCACCTGCT 0: 1
1: 0
2: 4
3: 32
4: 289
Right 1124014231 15:25862652-25862674 TGAAGACCAGGCAGCCCAGGTGG 0: 1
1: 1
2: 1
3: 28
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type