ID: 1124014239

View in Genome Browser
Species Human (GRCh38)
Location 15:25862679-25862701
Sequence TCTTGTGGTCGGAGCGGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124014232_1124014239 -2 Left 1124014232 15:25862658-25862680 CCAGGCAGCCCAGGTGGTTGATC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014222_1124014239 26 Left 1124014222 15:25862630-25862652 CCCGCCCGCCCAACTCACCTGCT 0: 1
1: 0
2: 4
3: 32
4: 289
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014225_1124014239 21 Left 1124014225 15:25862635-25862657 CCGCCCAACTCACCTGCTGAAGA 0: 1
1: 0
2: 2
3: 18
4: 302
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014234_1124014239 -10 Left 1124014234 15:25862666-25862688 CCCAGGTGGTTGATCTTGTGGTC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014224_1124014239 22 Left 1124014224 15:25862634-25862656 CCCGCCCAACTCACCTGCTGAAG 0: 1
1: 0
2: 0
3: 30
4: 305
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014223_1124014239 25 Left 1124014223 15:25862631-25862653 CCGCCCGCCCAACTCACCTGCTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014229_1124014239 9 Left 1124014229 15:25862647-25862669 CCTGCTGAAGACCAGGCAGCCCA 0: 1
1: 0
2: 0
3: 24
4: 243
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014226_1124014239 18 Left 1124014226 15:25862638-25862660 CCCAACTCACCTGCTGAAGACCA 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1124014227_1124014239 17 Left 1124014227 15:25862639-25862661 CCAACTCACCTGCTGAAGACCAG 0: 1
1: 0
2: 2
3: 20
4: 243
Right 1124014239 15:25862679-25862701 TCTTGTGGTCGGAGCGGTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124014239 Original CRISPR TCTTGTGGTCGGAGCGGTGG CGG Exonic