ID: 1124023840

View in Genome Browser
Species Human (GRCh38)
Location 15:25946485-25946507
Sequence GGAGGGCTTGGGCAGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023840_1124023853 20 Left 1124023840 15:25946485-25946507 CCGCCCTCCTGCCCAAGCCCTCC No data
Right 1124023853 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
1124023840_1124023854 26 Left 1124023840 15:25946485-25946507 CCGCCCTCCTGCCCAAGCCCTCC No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023840_1124023851 7 Left 1124023840 15:25946485-25946507 CCGCCCTCCTGCCCAAGCCCTCC No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023840 Original CRISPR GGAGGGCTTGGGCAGGAGGG CGG (reversed) Intergenic