ID: 1124023841

View in Genome Browser
Species Human (GRCh38)
Location 15:25946488-25946510
Sequence CTTGGAGGGCTTGGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023841_1124023851 4 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023841_1124023853 17 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023853 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
1124023841_1124023854 23 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023841_1124023855 28 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023855 15:25946539-25946561 TCAGACAACAGGCTCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023841 Original CRISPR CTTGGAGGGCTTGGGCAGGA GGG (reversed) Intergenic