ID: 1124023843

View in Genome Browser
Species Human (GRCh38)
Location 15:25946492-25946514
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023843_1124023851 0 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023843_1124023853 13 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023853 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
1124023843_1124023855 24 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023855 15:25946539-25946561 TCAGACAACAGGCTCAGGACAGG No data
1124023843_1124023854 19 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023843 Original CRISPR CTGTCTTGGAGGGCTTGGGC AGG (reversed) Intergenic