ID: 1124023848

View in Genome Browser
Species Human (GRCh38)
Location 15:25946502-25946524
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023848_1124023853 3 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023853 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
1124023848_1124023854 9 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023848_1124023857 24 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023857 15:25946549-25946571 GGCTCAGGACAGGAAGTGCCGGG No data
1124023848_1124023856 23 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023848_1124023855 14 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023855 15:25946539-25946561 TCAGACAACAGGCTCAGGACAGG No data
1124023848_1124023858 28 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023858 15:25946553-25946575 CAGGACAGGAAGTGCCGGGTCGG No data
1124023848_1124023851 -10 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023848 Original CRISPR TGCTTCCTTCCTGTCTTGGA GGG (reversed) Intergenic