ID: 1124023850

View in Genome Browser
Species Human (GRCh38)
Location 15:25946506-25946528
Sequence GTTCTGCTTCCTTCCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023850_1124023858 24 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023858 15:25946553-25946575 CAGGACAGGAAGTGCCGGGTCGG No data
1124023850_1124023856 19 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023850_1124023855 10 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023855 15:25946539-25946561 TCAGACAACAGGCTCAGGACAGG No data
1124023850_1124023853 -1 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023853 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
1124023850_1124023854 5 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023850_1124023857 20 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023857 15:25946549-25946571 GGCTCAGGACAGGAAGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023850 Original CRISPR GTTCTGCTTCCTTCCTGTCT TGG (reversed) Intergenic
No off target data available for this crispr