ID: 1124023851

View in Genome Browser
Species Human (GRCh38)
Location 15:25946515-25946537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023841_1124023851 4 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023845_1124023851 -4 Left 1124023845 15:25946496-25946518 CCCAAGCCCTCCAAGACAGGAAG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023838_1124023851 24 Left 1124023838 15:25946468-25946490 CCCTTCTAGGAGGGCTGCCGCCC No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023839_1124023851 23 Left 1124023839 15:25946469-25946491 CCTTCTAGGAGGGCTGCCGCCCT No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023846_1124023851 -5 Left 1124023846 15:25946497-25946519 CCAAGCCCTCCAAGACAGGAAGG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023842_1124023851 3 Left 1124023842 15:25946489-25946511 CCTCCTGCCCAAGCCCTCCAAGA No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023848_1124023851 -10 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023843_1124023851 0 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023837_1124023851 25 Left 1124023837 15:25946467-25946489 CCCCTTCTAGGAGGGCTGCCGCC No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data
1124023840_1124023851 7 Left 1124023840 15:25946485-25946507 CCGCCCTCCTGCCCAAGCCCTCC No data
Right 1124023851 15:25946515-25946537 GAAGGAAGCAGAACCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023851 Original CRISPR GAAGGAAGCAGAACCTACAG AGG Intergenic
No off target data available for this crispr