ID: 1124023852

View in Genome Browser
Species Human (GRCh38)
Location 15:25946528-25946550
Sequence CCTGTTGTCTGATCCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023852_1124023856 -3 Left 1124023852 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023852_1124023857 -2 Left 1124023852 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
Right 1124023857 15:25946549-25946571 GGCTCAGGACAGGAAGTGCCGGG No data
1124023852_1124023858 2 Left 1124023852 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
Right 1124023858 15:25946553-25946575 CAGGACAGGAAGTGCCGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023852 Original CRISPR CCTGTTGTCTGATCCTCTGT AGG (reversed) Intergenic
No off target data available for this crispr