ID: 1124023854

View in Genome Browser
Species Human (GRCh38)
Location 15:25946534-25946556
Sequence GAGGATCAGACAACAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023850_1124023854 5 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023848_1124023854 9 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023849_1124023854 8 Left 1124023849 15:25946503-25946525 CCTCCAAGACAGGAAGGAAGCAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023843_1124023854 19 Left 1124023843 15:25946492-25946514 CCTGCCCAAGCCCTCCAAGACAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023845_1124023854 15 Left 1124023845 15:25946496-25946518 CCCAAGCCCTCCAAGACAGGAAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023842_1124023854 22 Left 1124023842 15:25946489-25946511 CCTCCTGCCCAAGCCCTCCAAGA No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023846_1124023854 14 Left 1124023846 15:25946497-25946519 CCAAGCCCTCCAAGACAGGAAGG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023840_1124023854 26 Left 1124023840 15:25946485-25946507 CCGCCCTCCTGCCCAAGCCCTCC No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data
1124023841_1124023854 23 Left 1124023841 15:25946488-25946510 CCCTCCTGCCCAAGCCCTCCAAG No data
Right 1124023854 15:25946534-25946556 GAGGATCAGACAACAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023854 Original CRISPR GAGGATCAGACAACAGGCTC AGG Intergenic