ID: 1124023856

View in Genome Browser
Species Human (GRCh38)
Location 15:25946548-25946570
Sequence AGGCTCAGGACAGGAAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124023848_1124023856 23 Left 1124023848 15:25946502-25946524 CCCTCCAAGACAGGAAGGAAGCA No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023849_1124023856 22 Left 1124023849 15:25946503-25946525 CCTCCAAGACAGGAAGGAAGCAG No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023845_1124023856 29 Left 1124023845 15:25946496-25946518 CCCAAGCCCTCCAAGACAGGAAG No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023850_1124023856 19 Left 1124023850 15:25946506-25946528 CCAAGACAGGAAGGAAGCAGAAC No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023852_1124023856 -3 Left 1124023852 15:25946528-25946550 CCTACAGAGGATCAGACAACAGG No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data
1124023846_1124023856 28 Left 1124023846 15:25946497-25946519 CCAAGCCCTCCAAGACAGGAAGG No data
Right 1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124023856 Original CRISPR AGGCTCAGGACAGGAAGTGC CGG Intergenic
No off target data available for this crispr