ID: 1124029971

View in Genome Browser
Species Human (GRCh38)
Location 15:26001593-26001615
Sequence ACCAGGCCGCTGAGGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124029971_1124029978 13 Left 1124029971 15:26001593-26001615 CCTGGGGCCCTCAGCGGCCTGGT No data
Right 1124029978 15:26001629-26001651 CCACTCATGCTTTTCTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124029971 Original CRISPR ACCAGGCCGCTGAGGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr