ID: 1124030940

View in Genome Browser
Species Human (GRCh38)
Location 15:26011291-26011313
Sequence ACATATTAGGAATAAACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124030940_1124030944 6 Left 1124030940 15:26011291-26011313 CCCCATGTTTATTCCTAATATGT No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124030940 Original CRISPR ACATATTAGGAATAAACATG GGG (reversed) Intergenic
No off target data available for this crispr