ID: 1124030943

View in Genome Browser
Species Human (GRCh38)
Location 15:26011304-26011326
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124030943_1124030944 -7 Left 1124030943 15:26011304-26011326 CCTAATATGTATATGTCAGTATA No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data
1124030943_1124030945 21 Left 1124030943 15:26011304-26011326 CCTAATATGTATATGTCAGTATA No data
Right 1124030945 15:26011348-26011370 TTCCTTAAATTGCATATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124030943 Original CRISPR TATACTGACATATACATATT AGG (reversed) Intergenic
No off target data available for this crispr