ID: 1124030944

View in Genome Browser
Species Human (GRCh38)
Location 15:26011320-26011342
Sequence CAGTATATGTTGTTGTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124030942_1124030944 4 Left 1124030942 15:26011293-26011315 CCATGTTTATTCCTAATATGTAT No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data
1124030941_1124030944 5 Left 1124030941 15:26011292-26011314 CCCATGTTTATTCCTAATATGTA No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data
1124030940_1124030944 6 Left 1124030940 15:26011291-26011313 CCCCATGTTTATTCCTAATATGT No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data
1124030943_1124030944 -7 Left 1124030943 15:26011304-26011326 CCTAATATGTATATGTCAGTATA No data
Right 1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124030944 Original CRISPR CAGTATATGTTGTTGTATTT TGG Intergenic
No off target data available for this crispr