ID: 1124035741

View in Genome Browser
Species Human (GRCh38)
Location 15:26052355-26052377
Sequence CTTCCTTTGCAGGCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124035737_1124035741 11 Left 1124035737 15:26052321-26052343 CCTAACTCACTGTGTTTTCTTAT No data
Right 1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG 0: 1
1: 1
2: 3
3: 21
4: 280
1124035735_1124035741 13 Left 1124035735 15:26052319-26052341 CCCCTAACTCACTGTGTTTTCTT No data
Right 1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG 0: 1
1: 1
2: 3
3: 21
4: 280
1124035736_1124035741 12 Left 1124035736 15:26052320-26052342 CCCTAACTCACTGTGTTTTCTTA No data
Right 1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG 0: 1
1: 1
2: 3
3: 21
4: 280
1124035733_1124035741 28 Left 1124035733 15:26052304-26052326 CCACTGTTGTGGTTCCCCCTAAC No data
Right 1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG 0: 1
1: 1
2: 3
3: 21
4: 280
1124035734_1124035741 14 Left 1124035734 15:26052318-26052340 CCCCCTAACTCACTGTGTTTTCT No data
Right 1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG 0: 1
1: 1
2: 3
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124035741 Original CRISPR CTTCCTTTGCAGGCAGTGGA AGG Intergenic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900597788 1:3490396-3490418 CTTCCTTTGAGGGCCGTGGAGGG - Exonic
900893207 1:5464642-5464664 CTTTCCCTGCAGGCGGTGGAAGG - Intergenic
903686745 1:25137210-25137232 CTTCCTCTGCAGGAAGAGGGTGG - Intergenic
903965844 1:27088917-27088939 CTTCCCTGGCAAGCTGTGGAGGG + Intergenic
904133501 1:28292902-28292924 TTCCCTTGGAAGGCAGTGGAAGG - Intergenic
904750280 1:32737529-32737551 CTGGCCTTGCAGGCAGCGGAGGG - Intergenic
905276314 1:36820837-36820859 CTTCCTTAGAAGGCAGTAGGTGG - Intronic
907059787 1:51409725-51409747 TTTTCTTTGCGGGCAGGGGAGGG + Intronic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
910065986 1:83151366-83151388 CTTTCTTGGCAGGCAGTCCAGGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
912502518 1:110131463-110131485 CTACCTCAGCAGGCAGTGGAGGG + Intergenic
915022795 1:152797089-152797111 CTTCCCTTGCAGGCAGAGACAGG - Intronic
915092015 1:153433111-153433133 CGTCCTTTGAAGGCAGGGGTTGG + Intergenic
915664881 1:157435244-157435266 CTTCCTTTCCAGGAAGTGGCTGG + Intergenic
916472275 1:165136107-165136129 CTTCCTATAGAGGAAGTGGAGGG + Intergenic
916548330 1:165827624-165827646 CTTCCTTTGCCCGCAGCGGCTGG - Exonic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
917556076 1:176090010-176090032 CTACCTTTAGAGGCAGTAGATGG - Intronic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920301582 1:204992265-204992287 CTTACATGCCAGGCAGTGGAGGG + Intronic
922110157 1:222548214-222548236 CTCCCTTTGAAAGCAGTGGGAGG + Intergenic
923566068 1:235076872-235076894 CTTCCTATCGAGGCACTGGACGG + Intergenic
1064300744 10:14120649-14120671 CTTTCCTTGCAGTTAGTGGAGGG + Intronic
1066271852 10:33831700-33831722 CCTCTCTTGCAGGCAGAGGATGG + Intergenic
1067828762 10:49597980-49598002 GTTCCCTTCCAGGCAGAGGAAGG + Intergenic
1069530064 10:69211072-69211094 CTTCCTTTGGAGGGAAAGGAGGG + Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070765056 10:79051661-79051683 GTTCCTTTGCACGCGCTGGAAGG - Intergenic
1071528169 10:86370294-86370316 CTTTCTTTGCAGGCAGGGCCTGG - Intergenic
1072460388 10:95612955-95612977 CTTCCTTTCCAGTCAAAGGATGG + Intronic
1073925770 10:108513508-108513530 CTTCCTGTGCAGTCACTGGCGGG - Intergenic
1074549592 10:114430176-114430198 CTGCCTTTGCTGGGAGTGGAAGG - Intergenic
1075595390 10:123725445-123725467 CTTACCTTCCAGGCAGTGCATGG + Intronic
1075706349 10:124504283-124504305 CTTATTTTCCAGGCAGTGGCAGG - Intronic
1078081553 11:8207846-8207868 CTTCCTCTGTAGGCACTGGCTGG + Intergenic
1078352582 11:10606747-10606769 CTTCCTTTTCAGTGAGTGGAGGG + Exonic
1078991791 11:16655190-16655212 CTTCCTGAGCTGGCAGTGAAAGG + Intronic
1080765070 11:35288393-35288415 CCTCATTTGCATGCAGGGGATGG + Intronic
1081666794 11:44921272-44921294 CTTCCATGGCAGGCAGGGGTGGG + Intronic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1084507344 11:69576431-69576453 TTTGCTTTGCAAGCAGTGAATGG - Intergenic
1084904958 11:72338491-72338513 CTTCCTTAGCACCCACTGGAAGG + Intronic
1089191936 11:116659898-116659920 CTTCCTCAGGAGGCAGGGGAAGG - Intergenic
1089582770 11:119491814-119491836 CTTCTTTCTCAGGCAGTGAAGGG + Intergenic
1089771006 11:120802883-120802905 CTTCCCTTGCTGGCAGAGGATGG + Intronic
1091122279 11:133066119-133066141 CCTCCTTGGCAGGCAGAGGCGGG - Intronic
1092892077 12:12978556-12978578 ATCCCTCTGCTGGCAGTGGAGGG + Intronic
1092938452 12:13385828-13385850 CTTTCTTTGCATGCATTGGCAGG + Intronic
1093054053 12:14536796-14536818 ATTCCCTTGCAGGCTGTGCATGG + Intronic
1096023394 12:48340624-48340646 CTTTCTTTGAAGGCAGTTTAGGG + Exonic
1096871654 12:54596266-54596288 CTTCCTTGGGAGGGAGGGGATGG + Intergenic
1097737095 12:63194460-63194482 TTTTCTTTGAAGGCAGAGGAGGG + Intergenic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1100267693 12:92993354-92993376 CTTCCTTTCCTGGCAGGGGAGGG - Intergenic
1101532875 12:105590418-105590440 CTTCCGGGGCAGGAAGTGGATGG - Intergenic
1101637582 12:106558320-106558342 CTTCCTTTGGAGGTAATGGCTGG - Intronic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102586596 12:113927342-113927364 CTGCCTCTGCGGGCAGTGGCAGG + Intronic
1104506659 12:129338590-129338612 CTTCCTTTTCAGGCAGAGGCAGG - Intronic
1104560352 12:129838501-129838523 CTTTCTTTGGATTCAGTGGAAGG - Intronic
1104682629 12:130761975-130761997 CGCCCTGTGCAGGCATTGGAGGG + Intergenic
1104689459 12:130814423-130814445 CTTCCATTCCAGGCAGAAGAAGG + Intronic
1104808882 12:131608027-131608049 CTCACTTTGCATGCAGTGGCTGG + Intergenic
1104959004 12:132479363-132479385 GTTCCTCTGCAGGCTGTGGGAGG + Intergenic
1105704380 13:22960339-22960361 CTGACTTTGCAGGCAGGGAAGGG + Intergenic
1105857331 13:24385391-24385413 CTGACTTTGCAGGCAGGGAAGGG + Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1106469115 13:30039020-30039042 CTTCCTTAGCAAGCAGTCCAAGG - Intergenic
1106546991 13:30739286-30739308 CTGCCTTTGCAGAGACTGGAGGG + Intronic
1107559648 13:41547661-41547683 CTTGCTGAGCAGGCAGTGAAAGG - Intergenic
1107985604 13:45773664-45773686 CTGCCTGTACATGCAGTGGATGG - Intergenic
1109767313 13:66919755-66919777 CTTCCTTGACAGGCAGAAGAGGG - Intronic
1110817385 13:79876964-79876986 CTGGCTTTGAAGACAGTGGAAGG - Intergenic
1112562333 13:100525791-100525813 CTTCCTCTGCAGGCATCTGAGGG - Intronic
1112652086 13:101410636-101410658 CTTTCTTTGAAGGCATTGAATGG - Intronic
1112977916 13:105343827-105343849 CTGGCTTTTCAGGCAGTGGGGGG - Intergenic
1113047908 13:106175567-106175589 CTGCCTTTACAGGAAGTGGGTGG - Intergenic
1113096591 13:106671708-106671730 CTCCCTTTGCTTGCACTGGATGG + Intergenic
1113394911 13:109938337-109938359 CTTCTTTTACAGGCAGAGGCCGG - Intergenic
1113467361 13:110521595-110521617 CTTTCTTTGAAGGCTGTGAAGGG - Intergenic
1113965163 13:114148683-114148705 CTTCCTTTGCTGGCAGGGCTGGG + Intergenic
1116563776 14:46418734-46418756 CTTCCTTTGGGGCCAGTGGGAGG + Intergenic
1117073329 14:52075684-52075706 CTACCCTTGAAGACAGTGGAGGG - Intergenic
1119879772 14:78091054-78091076 CTGCCTTTGGAGGCATGGGAAGG + Intergenic
1120125769 14:80741087-80741109 CTTGCTTTCCAGGCACTGGGTGG - Intronic
1122785877 14:104163045-104163067 CTTCCCTTGCAGGCAGCTGGCGG + Intronic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124226889 15:27902732-27902754 CTTCCTCTGCAGGCTGGGGGCGG + Intronic
1124439039 15:29674107-29674129 CATCCTCTGCAGGCTGGGGAAGG - Intergenic
1124787910 15:32699154-32699176 CTCACTTTGAAGGCAGTGGGAGG - Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1127376176 15:58387118-58387140 CTTGCTTTGCATGGAGAGGATGG + Intronic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1128443068 15:67731483-67731505 CTTCCTTGGCATGCAGTTTAGGG + Intronic
1129284535 15:74513809-74513831 CATCTTTTGCAGGCTGCGGATGG - Intergenic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1130665412 15:85865197-85865219 ATTCCTTCCCAGGCTGTGGAGGG + Intergenic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131489510 15:92850331-92850353 ATGCCTGTGCAGGCTGTGGAAGG - Intergenic
1131783718 15:95888186-95888208 TTTCCTTTCCAGGCAGAGCAGGG - Intergenic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1132414014 15:101607820-101607842 CTGCCTTTGAAGGCGGAGGAAGG + Intergenic
1134068515 16:11246019-11246041 CTCCCTTTGCAGGCATTAGGAGG - Intergenic
1135846509 16:25923697-25923719 CTTTCTGTGCAGGCAGTGAGAGG - Intronic
1136383098 16:29906067-29906089 CTTCCTTCGCAGGGAGAGGCTGG + Intronic
1136716905 16:32288810-32288832 TTCCCTCTGCAGGCAGGGGAGGG - Intergenic
1137937734 16:52650570-52650592 TTACCATTGCAGGCAGTAGAAGG - Intergenic
1139580010 16:67867454-67867476 CTGCCCTTGAAGGCTGTGGAAGG + Intronic
1141199589 16:81886984-81887006 CTTTCTTTGCAGCCAGTCCAGGG + Intronic
1141506296 16:84480698-84480720 CTTCCTTTGCAGGGTATGGGGGG - Exonic
1142000753 16:87662874-87662896 TTTTCCCTGCAGGCAGTGGAAGG - Intronic
1142014248 16:87735491-87735513 GTTCCCATGCAGGCAGTGAAAGG - Intronic
1203145453 16_KI270728v1_random:1795376-1795398 TTCCCTCTGCAGGCAGGGGAGGG - Intergenic
1142589913 17:998858-998880 CTTCTTTTGCAGTCGGTGTACGG - Exonic
1143267868 17:5653917-5653939 CTGGCTTTGTAGGTAGTGGAAGG + Intergenic
1144021975 17:11245699-11245721 GCTCCTGTGCAGGCAGTGGAAGG - Intronic
1144782615 17:17815543-17815565 TTTCCTTTGGAAGCAGTGTAGGG - Intronic
1145198975 17:20922612-20922634 CTTCCTTTGCAAGTTGGGGAGGG - Intergenic
1145276639 17:21435343-21435365 CTTGCTTTCCAGCCACTGGAAGG + Intergenic
1145727937 17:27150314-27150336 CTTTCTGTACAGGCAGTGAAGGG + Intergenic
1145936007 17:28715266-28715288 CTCCCATGGCAGGCAGTGGCTGG - Exonic
1145984011 17:29032176-29032198 CTTTCTTTGCAGGCATGGGTGGG + Intronic
1146298819 17:31672345-31672367 CTTTCTGAGCAGGCAGAGGAGGG - Intergenic
1146538004 17:33669973-33669995 CTTCCTGTAGAGACAGTGGAGGG + Intronic
1146904283 17:36608256-36608278 CTCCATTTGCAGCCAGAGGAAGG + Exonic
1147139781 17:38454395-38454417 CTCGGTTTCCAGGCAGTGGAAGG + Intronic
1148580808 17:48742503-48742525 TTTCTTTGGCAGGGAGTGGAGGG - Intergenic
1148739871 17:49886699-49886721 CTTCCTTTTCAGACAGGGGAAGG + Intergenic
1149914104 17:60592731-60592753 CTTCTTTTACAGGCAATCGAGGG - Intergenic
1150512925 17:65775348-65775370 CTGCCTCTGCACGCAGGGGAAGG + Intronic
1150607356 17:66705717-66705739 CTTCATTTACAGGAACTGGAAGG + Intronic
1152727208 17:81953257-81953279 TTTCCTCTGCAGCCACTGGACGG - Exonic
1152842459 17:82579112-82579134 CGTCCTTCTCAGGCAGTGGCTGG + Intronic
1153019512 18:614162-614184 CCTCCTTTGCAGGCAAAGGTTGG - Intronic
1153234135 18:2969621-2969643 CTTCTATTGCAGGCAGTCCAAGG - Intronic
1153369378 18:4296877-4296899 CTTTCTGAGCAGGCAATGGATGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153591936 18:6683340-6683362 CACCCTGGGCAGGCAGTGGAAGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1155029569 18:21972540-21972562 TTTCCCTTGCAGTCAGTGAATGG + Intergenic
1155615780 18:27719694-27719716 CTTGCTTTGAAGACAGTGGACGG + Intergenic
1160159316 18:76459428-76459450 CCTCCCTGGCCGGCAGTGGAGGG - Intronic
1160186363 18:76679482-76679504 CTTCCCTGGAAGGCGGTGGAGGG - Intergenic
1163360281 19:16841679-16841701 GTTCCTGTGCAGACAGTGGCTGG + Intronic
1164839806 19:31384334-31384356 CTACCTTTGAAGGCAGTGTTAGG + Intergenic
1165797423 19:38527061-38527083 CTTCTTTTGCTTGCAGAGGAAGG - Intronic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
925006599 2:447789-447811 CTGCCTTAACAGGCAGGGGAGGG + Intergenic
925435408 2:3833086-3833108 CTGCCTTTGAAGACAGAGGAAGG - Intronic
926734052 2:16058980-16059002 CTTCATTTTCAGGCAGTGGAAGG - Intergenic
928918642 2:36502234-36502256 CTTCCTTCAAAGGCAGTTGAGGG - Intronic
929625970 2:43407056-43407078 CTTTCCTTGCAGGCAGTGGATGG + Intronic
929863550 2:45699181-45699203 CGTCCTTAGCAGGCAAAGGAGGG + Intronic
929939364 2:46320823-46320845 TTTCCTTTGCTGGTAGTGGTGGG + Intronic
930691583 2:54371083-54371105 ATTCCTTTCCAGGCAGTTGCAGG + Intronic
931507579 2:62948248-62948270 CTTCCTTTGAAGGCATACGATGG + Exonic
934125431 2:88884027-88884049 CATCCTTTGCAGGCTGAGGCAGG - Intergenic
934880521 2:97972820-97972842 CTGGCTTTGAAGGCAGGGGAAGG + Intronic
937863625 2:126732038-126732060 CTTCTTTTGCAGGCAGGGCTAGG - Intergenic
938763592 2:134445805-134445827 CTGCCTTTCCAGGCAGTGCATGG - Intronic
940275224 2:151932985-151933007 CTTCCCTTGCAGGCTTTAGAAGG + Intronic
942106467 2:172638388-172638410 CTTCCTATGAAGTCAGTGGGAGG + Intergenic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
943790995 2:191932438-191932460 ATACCTTTACAGGCAGTGAATGG - Intergenic
945282679 2:208050754-208050776 CTTTCTTTCCAGGCAGGGCATGG - Intergenic
945743349 2:213690377-213690399 CTGCCTCTGGAGGCAGTGTAAGG - Intronic
946038452 2:216763620-216763642 CTGCAAATGCAGGCAGTGGATGG - Intergenic
947846030 2:233244382-233244404 CTTCCTTTGGATGGAGGGGAAGG - Intronic
948324151 2:237098331-237098353 TATCCATTGCTGGCAGTGGAGGG + Exonic
948359751 2:237411942-237411964 TTTCCTATCCAGGCATTGGAGGG - Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1168876976 20:1178491-1178513 CTTTCTTTGCAGGCATTCCAGGG - Intronic
1169209151 20:3755997-3756019 TTTCCCTTGTAGGCAGTGGGTGG - Intronic
1170731861 20:18982965-18982987 CATCATTTGCAGGGAGTGGGAGG + Intergenic
1171424103 20:25038914-25038936 TTTCCTGTGCTGGCAGTGGCAGG - Intronic
1172931869 20:38592113-38592135 CTTCCTCTGCAGGGTTTGGAGGG - Intergenic
1175381258 20:58565995-58566017 CTTCCTTTGCAGGAGGGGCAGGG + Intergenic
1177019526 21:15836902-15836924 CATCCTTTGCTGTCAGTGTAGGG + Intronic
1178684970 21:34703466-34703488 GGTCCTTTGAAGGCAGTGGTGGG + Intronic
1179122018 21:38556684-38556706 CTTTCTTTTCAGCCAGTGGGTGG - Intronic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1180709497 22:17830243-17830265 GTGCCTGTGCAGGCAGTGGCTGG - Intronic
1181049549 22:20232030-20232052 CTTCCTGTCCAGCCAGTGGGTGG + Intergenic
1181918269 22:26298377-26298399 CCTCCTTCGCAGTCAGTAGATGG - Intronic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
951002052 3:17574253-17574275 CTTAATTTGGAGGCAATGGAAGG - Intronic
953337115 3:42102847-42102869 CTTCCTAGGCAGACAGGGGAGGG - Intronic
953687773 3:45091533-45091555 CTTCCTCTGCAGGAAAGGGAGGG + Exonic
953828725 3:46277182-46277204 TTTCCCTTCCAGGCAGTGGTGGG - Intergenic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
954622701 3:52005058-52005080 CTTACTTGGCAGGCTGTGGTGGG + Intergenic
954652287 3:52172407-52172429 CCCACATTGCAGGCAGTGGATGG + Intergenic
957165587 3:76668899-76668921 CTTTCTTTGGAGGAAGAGGATGG + Intronic
961360634 3:126365066-126365088 CCTCCTCTGCAGGCAGAGGTGGG - Intergenic
961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
965524338 3:169700387-169700409 CTTCCTTTGCATATAGGGGAGGG - Intergenic
965853548 3:173061050-173061072 CTTCCTTTGCTAGAATTGGAAGG + Intronic
966465363 3:180225578-180225600 CTTGCCTTGCAGCCAATGGAAGG + Intergenic
966735146 3:183181692-183181714 CTTCCTATTCATGCAGGGGATGG - Intronic
968288394 3:197521345-197521367 CTTCCAGTTCAGCCAGTGGAGGG - Intronic
969493267 4:7511930-7511952 CTCCCTTTGCAGGTCCTGGAGGG + Intronic
969588444 4:8107919-8107941 CTGGCTTTGAAGGCAGAGGAAGG + Intronic
973183257 4:47294018-47294040 CTTCCTTTTTATGCTGTGGAGGG - Intronic
974876946 4:67713072-67713094 CTTGCTGGGCAGGCAGTGGCAGG - Intergenic
975226462 4:71877919-71877941 CTTCATTTACAGGCAAGGGATGG + Intergenic
976595396 4:86890979-86891001 ATACTTTGGCAGGCAGTGGATGG - Intronic
977957193 4:103043308-103043330 CTTTCCTTGCAGGCATGGGATGG - Exonic
977991712 4:103451072-103451094 CTTCCTTTGCAGCCTGTCGATGG + Intergenic
980220557 4:129908377-129908399 CTTACATTGTAGGCAGTGAAAGG - Intergenic
982007119 4:151074314-151074336 CTTCCATAGCAGGAAGAGGAGGG + Intergenic
982216788 4:153089276-153089298 ATTTCTTTGCAGGAAGTGTAAGG + Intergenic
984855203 4:184189182-184189204 CTTCCTTTCCTGGCCATGGAAGG + Intronic
985007990 4:185553699-185553721 CATCCTTGTCATGCAGTGGAGGG + Intergenic
985041227 4:185893697-185893719 CTTCCATTCCAGGCGATGGAAGG + Intronic
989635089 5:43523505-43523527 CTTCCTGTACAGGAAGAGGAGGG + Intergenic
990372829 5:55137872-55137894 CTCCCTTTGCAGGCACTTGAGGG - Intronic
990684038 5:58279225-58279247 CTACTTTTGCAGGCAGTGTATGG - Intergenic
991136015 5:63183074-63183096 CTTCCTATGCAGGGAATGGTAGG - Intergenic
992030886 5:72720335-72720357 CTCCCTTTCCGGGCAGTGAATGG + Intergenic
992122771 5:73611534-73611556 CTTCCCGTGCTGGCAGTGGTGGG - Intergenic
994233732 5:97338098-97338120 CTACCTTTGCAGTTGGTGGATGG + Intergenic
994324548 5:98434755-98434777 GTTCTTTTGCAGGCAGGGGCAGG - Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995736567 5:115307286-115307308 ATTTATTTGCAGGCAGTTGAGGG - Intergenic
996524414 5:124462883-124462905 CTTCCTTGGCTGGAAGTGAATGG - Intergenic
997357592 5:133273750-133273772 CTACGTTTGCAGGCAGCGGAAGG + Intronic
997658688 5:135574026-135574048 CTTCCTTCGCAGGTGCTGGAAGG - Intronic
998732879 5:145101072-145101094 CTTCCTTAGCAAGCAGTCCACGG - Intergenic
1000048600 5:157542458-157542480 CTTCATTTCCAGGCTTTGGAAGG - Intronic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001485613 5:172117548-172117570 CTTGCTGTGCAGGAAGTTGAGGG + Exonic
1001574292 5:172751790-172751812 CTTCCTGTGCAGACAGTCCATGG + Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1003590433 6:7432452-7432474 CTGCCTCTGGAGGCAGGGGATGG + Intergenic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1005417307 6:25613896-25613918 CTTTCTTGGGAGGCAGTGAAGGG - Intronic
1008669098 6:53748347-53748369 CTGCCTTTGAAGACAGAGGAAGG + Intergenic
1010324351 6:74547821-74547843 CTTCCATAGCCTGCAGTGGAAGG + Intergenic
1012205979 6:96460533-96460555 CTGCCTTTGCAGGCCGGGGCTGG + Intergenic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1017599108 6:156061532-156061554 CTTCCCTGGGAGGCATTGGATGG + Intergenic
1017827372 6:158091916-158091938 CTTGCTTTCCAGGGACTGGAAGG + Intronic
1022010221 7:26302355-26302377 ACTCCTTTGCAGGCAGGAGATGG + Intronic
1022596805 7:31720391-31720413 CTTACGATGTAGGCAGTGGAAGG - Intergenic
1023561700 7:41480620-41480642 CTTCTGTTGCATGCAGTGGGTGG + Intergenic
1023987739 7:45107004-45107026 CTCCCTTTGCAGGCAGTTGAGGG - Intronic
1024058289 7:45680043-45680065 CTTCCTGTCTAGGCAGGGGAGGG - Intronic
1024646474 7:51375259-51375281 CCTTCTTTCCAGGCAGTGGTGGG + Intergenic
1024718966 7:52113316-52113338 CTTCCTTTGGAGGCAGAAGTTGG - Intergenic
1027278123 7:76583409-76583431 CTTTCTTGGCAGGCAGTCCAGGG - Intergenic
1028094264 7:86740955-86740977 CAACCTTTGCAGGCAGATGAAGG + Intronic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1029283148 7:99449581-99449603 CCCCCTTTCCAGGCACTGGAGGG + Intronic
1030699185 7:112620082-112620104 CTGCCATTGCAGGCAGGTGAGGG - Intergenic
1034368283 7:150570784-150570806 CTTCCTTTTAAGGCAGTTGCAGG + Intronic
1034429305 7:151033239-151033261 CTTCCTGTCCAGGCAGTGTGTGG + Intronic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1036526375 8:9538621-9538643 CTTCCTTTGCAAGTTGTGGATGG + Intergenic
1036550213 8:9809098-9809120 GTTCTTTTGCAGGCAGGGGCAGG - Intergenic
1036716321 8:11127573-11127595 CTAGCTTTGAAGGCAGAGGAAGG - Intronic
1037387613 8:18360268-18360290 CTTCCTCTGCAGACTTTGGAAGG + Intergenic
1037390949 8:18391253-18391275 CTTCCCTTGCAGACTTTGGAAGG + Exonic
1042955907 8:74250485-74250507 CTTCCTTTCCAGGAAGGGGCAGG + Intronic
1043224799 8:77712443-77712465 CTTTCTTTGAAGTCAGTGGAAGG + Intergenic
1044404607 8:91813638-91813660 CTCCCTTTGCAAGCAGTTCAGGG + Intergenic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1045285698 8:100789417-100789439 CTTCCTCCCCAGGCAGTGGAGGG + Intergenic
1050847402 9:10239522-10239544 CTTCATTTCCAGGTAGTGAAAGG + Intronic
1053282602 9:36830762-36830784 CTTCCTTAGGAGGCAGCGAAGGG - Intergenic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055440491 9:76331762-76331784 CTGCCTTTGAAGACAGAGGAAGG + Intronic
1056386409 9:86100117-86100139 TTTCCGTTGCTAGCAGTGGAAGG - Intronic
1056838675 9:89979839-89979861 CTTCCACTGCAGGTAGTGGTAGG - Intergenic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1058281074 9:103115498-103115520 TGGCCTTTGCAGGCATTGGAAGG - Intergenic
1059298618 9:113295151-113295173 CATCTTTTGTAGTCAGTGGAGGG - Intergenic
1060104836 9:120867051-120867073 CTTCCCTTTCTGCCAGTGGAGGG - Intronic
1060636008 9:125200412-125200434 CTTCCTGGGCTGGCGGTGGAGGG - Intergenic
1061258909 9:129468337-129468359 CTGACTTTGCAGCCAGTGGGTGG + Intergenic
1061526635 9:131170342-131170364 TTTCCTTTGAAGGCTGAGGAAGG - Intronic
1061746731 9:132745648-132745670 CTTTCTTTCCGGGTAGTGGAGGG + Intronic
1062307223 9:135914837-135914859 CTGGCTTTGAAGGCAGAGGAAGG + Intergenic
1062633314 9:137477121-137477143 CTTCCTTTGGGGGCAGCGGTAGG + Intronic
1188000633 X:24977479-24977501 TTTCCTTTGCACCCAGTGCATGG + Intronic
1189105168 X:38228149-38228171 CTTCCTGTGCTGGCAGCGGGAGG + Intronic
1189360729 X:40348862-40348884 CTGCCATGGCAGGCTGTGGAAGG - Intergenic
1189753081 X:44242793-44242815 GTTACTTTGGAGGCAATGGAGGG - Intronic
1193870962 X:86797990-86798012 CATCTATTGCTGGCAGTGGAGGG - Intronic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1197371351 X:125629271-125629293 CATCCTTTGTTGGCAGGGGAGGG + Intergenic
1198407339 X:136326570-136326592 CTTCCTTTGGAGGTAATGGCTGG + Intronic
1198485830 X:137086796-137086818 ATTCCTTTTCAGGCTCTGGATGG + Intergenic
1198717634 X:139576924-139576946 CTTATTTTTCAGGCAGTGAAGGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic