ID: 1124036033

View in Genome Browser
Species Human (GRCh38)
Location 15:26054359-26054381
Sequence GTGTCCACACTGGCCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124036033_1124036044 22 Left 1124036033 15:26054359-26054381 CCCCCCATGGCCAGTGTGGACAC No data
Right 1124036044 15:26054404-26054426 TAAAGCAATTACATTTTCCTTGG No data
1124036033_1124036041 -2 Left 1124036033 15:26054359-26054381 CCCCCCATGGCCAGTGTGGACAC No data
Right 1124036041 15:26054380-26054402 ACAATGCTATGGGAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124036033 Original CRISPR GTGTCCACACTGGCCATGGG GGG (reversed) Intergenic