ID: 1124036431

View in Genome Browser
Species Human (GRCh38)
Location 15:26057294-26057316
Sequence GGCCCCAGTGCAGGATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124036426_1124036431 3 Left 1124036426 15:26057268-26057290 CCAGACTGGCAGGCAGCTCCACC 0: 24
1: 20
2: 7
3: 36
4: 273
Right 1124036431 15:26057294-26057316 GGCCCCAGTGCAGGATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124036431 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG Intergenic
No off target data available for this crispr